Transcript asmbl_178430

Sequence
Transcript Sequence for observation asmbl_178430 of TGE0003205:
CGCTCGGGGCTGGTCCCTGCGGTCCCGGCTGCCTGGCCTTCCAGGGCTGGGTACTGCGGCTTCGGCGGCCTCGCTGAGGCCGGGGGCCAGGGGCCGTCCCGGGCTGCGGGGTGCGGGACGAGGGACTGCGAGTGCGAGGTCCCCCCTGGCACCTTGGAAGTTGTTTTCAACCATATCCAGCCTTTGCCGAATACATCCTATCTGCCACACATCCAGCGTGAGGTCCCTCCAGCTACAAGGTGGGCACCATGGCGGAGAAGTTTGACTGCCACTACTGCAGGGATCCCTTGCAGGGGAAGAAGTATGTGCAAAAGGATGGCCACCACTGCTGCCTGAAATGCTTTGACAAGTTCTGTGCCAACACCTGTGTGGAATGCCGCAAGCCCATCGGTGCGGACTCCAAGGAGGTGCACTATAAGAACCGCTTCTGGCATGACACCTGCTTCCGCTGTGCCAAGTGCCTTCACCCCTTGGCCAATGAGACCTTTGTGGCCAAGGACAACAAGATCCTGTGCAACAAGTGCACCACTCGGGAGGACTCCCCCAAGTGCAAGGGGTGCTTCAAGGCCATTGTGGCAGGAGATCAAAACGTGGAGTACAAGGGGACCGTCTGGCACAAAGACTGCTTCACCTGTAGTAACTGCAAGCAAGTCATCGGGACTGGAAGCTTCTTCCCTAAAGGGGAGGACTTCTACTGCGTGACTTGCCATGAGACCAAGTTTGCCAAGCATTGCGTGAAGTGCAACAAGGCCATCACATCTGGAGGAATCACTTACCAGGATCAGCCCTGGCATGCCGATTGCTTTGTGTGTGTTACCTGCTCTAAGAAGCTGGCTGGGCAGCGTTTCACCGCTGTGGAGGACCAGTATTACTGCGTGGATTGCTACAAGAACTTTGTGGCCAAGAAGTGTGCTGGATGCAAGAACCCCATCACTGGGTTTGGTAAAGGCTCCAGTGTGGTGGCCTATGAAGGACAATCCTGGCACGACTACTGCTTCCACTGCAAAAAATGCTCCGTGAATCTGGCCAACAAGCGCTTTGTTTTCCACCAGGAGCAAGTGTATTGTCCCGACTGTGCCAAAAAGCTGTAAACTGACAGGGGCTCCTGTCCTGTAAAATGGCATTTGAATCTCGTTCTTTGTGTCCTTACTTTCTGCCCTATACCATCAATAGGGGAAGAGTGGTCCTTCCCTTCTTTAAAGTTCTCCTTCCGTCTTTTCTCCCATTTTACAGTATTACTCAAATAAGGGCACACAGTGATCATATTAGCATTTAGCAAAAAGCAACCCTGCAGCAAAGTGAATTTCTGTCCGGCTGCAATTTAAAAATGAAAACTTAGGTAGATTGACTCTTCTGCATGTTTCTCATAGAGCAGAAAAGTGCTAATCATTTAGCCACTTAGTGATGTAAGCAAGAAGCATAGGAGATAAAACCCCCACTGAGATGCCTCTCATGCCTCAGCTGGGACCCACCGTGTAGACACACGACATGCAAGAGTTGCAGCGGCTGCTCCAACTCACTGCTCACCCTCTTCTGTGAGCAGGAAAAGAACCCTACTGACATGCATGGTTTAACTTCCTCATCAGAACTCTGCCCTTCCTTCTGTTCTTTTGTGCTTTCAAATAACTAACACGAACTTCCAGAAAATTAACATTTGAACTTAGCTGTAATTCTAAACTGACCTTTCCCCGTACTAACGTTTGGTTTCCCCGTGTGGCATGTTTTCTGAGCGTTCCTACTTTAAAGCATGGAACATGCAGGTGATTTGGGAAGTGTAGAAAGACCTGAGAAAACGAGCCTGTTTCAGAGGAACATCGTCACAACGAATACTTCTGGAAGCTTAACAAAACTAACCCTGCTGTCCTTTTTATTGTTTTTAATTAATATTTTTGTTTTAATTGATAGCAAAATAGTTTATGGGTTTGGAAACTTGCATGAAAATATTTTAGCCCCCTCAGATGTTCCTGCAGTGCTGAAATTCATCCTACGGAAGTAACCGCAAAACTCTAGAGGGGGAGTTGAGCAGGCGCCAGGGCTGTCATCAACATGGATATGACATTTCACAACAGTGACTAGTTGAATCCCTTGTAACGTAGTAGTTGTCTGCTCTTTGTCCATGTGTTAATGAGGACTGCAAAGTCCCTTCTGTTGTGATTCCTAGGACTTTTCCTCAAGAGGAAATCTGGATTTCCACCTACCGCTTACCTGAAATGCAGGATCACCTACTTACTGTATTCTACATTATTATATGACATAGTATAATGAGACAATATCAAAAGTAAACATGTAATGACAATACATACTAACATTCTTGTAGGAGTGGTTAGAGAAGCTGATGCCTCATTTCTACATTCTGTCATTAGCTATTATCATCTAACGTTTCAGTGTATCCTTACAGAAATAAAGCAGCATATGAATAACCTGCCTCCTGTCTTTTCATTCTGCCTGGTGGAATCGCTATAAGGTGATACTCCTAATCCAGAAACCTAAATGACTTATTTTCCTTCCAGGATATACTCACTTTAGTGCAGGCGCACAGAACATAGGAATTATAAACAAACCTGTAAAAACCAC