Transcript asmbl_178336

Sequence
Transcript Sequence for observation asmbl_178336 of TGE0058604:
CTTGATGGTATAGTTATTCTTTGTTTCTTGTTCCTCCATGCTCTTTATTTTTAACTCCTTCTAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATAACATTTTGAAGAATTCCTTTTGTGTTTTAAAATGTGATATATATATATATAAAATTCCTAGGATGCAGTGTCTCATTGTCCCCAACTTTACTACTGCTGCCGTCAATGGTGCTACTATATATGATCAAGATAACATGCTGACTAGTAACCATGAAGATTCAGATGTACCTCAGCAATGCGCCAGAGCAAAGTCTCTATTATTTTTCTACTAAAGAAATAAGGAAGTGAATTTACTTTTTGGGTCCAGAATGACTTTCTCCAAGAATTATAAGATGAAAATTATATATTTTGCCCAGTTACTAAAATGGTACATTAAAAATTCAATTAAGAGAAGAGTCACATTGAGTAAAATAAAAGACTGCAGTTTGTGGGAAGAATTATTTTTCACGGTGCTACTAATCCTGCTGTATCCCGGGTTTTTAATATAAAGGTGTTAAGCTTATTTTGCTTTGTAAGTAAAGAATGTGTATATTGTGAACAGCCTTTTAGCTCAAAATGTTGAGTCATTTACATATGACATAGCATGAATCACTCTTTACAGAAAATGTAGGAAACCCTAGAATACAGACAGCAATATTTTATATTCATGTTTATCAAAGTGAGAGGACTTATATTCCTACATCAAGTTACTACTGAGAGTAAATTTATTTTGAGTTTTATCCCGTAAGTTCTGTTTTGATTTTTTTTAAAAAACAAACCCTTTTAGTCACTTTAATCAGAATTTTAAATGTTCATGTTACATACCAAATTATAATATCTAATGGAGCAATTTGTCTTTTGCTATATTCTCCAAGATTATCTCTTAAGACCATATGCCCCCTGTTTTAATGTTTCTTACATCTTGTTTTTACTCATTTCTGACTGGACAAAGTTCTTCCAAACAATTCTGAGAAACAAAAACACACACGCAGAATTAACAATTCTTTTCCCTGTGCTTCTTATGTAAGAATCCTCCTGTGGCCTCTGCTTGTACAGAACTGGGAAACAACACTTGGTTAGTCTCTTTTAAGTTACAAAAAGCCAATTGATGTTTCTTATTCTTTTTAAATTTTAAATATTTTGTTATAAATACTCACAGGATACCTTATTTCCCTAGCTATCATCTCCTGACTTAATGTTTTTTAAACCCACC