Transcript asmbl_178335

Sequence
Transcript Sequence for observation asmbl_178335 of TGE0058603:
TCTTCTTCTTCTTTTTTTTTTCTTCCACTCTTAAAAAGCTTCTTTCTCTTCACCCAAGCCTCACTGTCCCTCTCCGGCTCTAGCTCTCTCCATATAAACCCTCAAGATTATGTCAATTGGTTAGAGCCAGCCGGGAATTTCGTGCGGGTGCTGAAGGAGCTGCGGGAGCCGGAGAAGAATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTACCAAAGGTGAAATGGGTATGATGGGACCTCCAGGCCCACCAGGACCTTTGGGAATTCCTGGCAGGAGTGGTGTACCTGGTCTTAAAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATAACATTTTGAAGAATTCCTTTTGTGTTTTAAAATGTGATATATATATATATAAAATTCCTAGGATGCAGTGTCTCATTGTCCCCAACTTTACTACTGCTGCCGTCAATGGTGCTACTATATATGATCAAGATAACATGCTGACTAGTAACCATGAAGATTCAGATGTACCTCAGCAATGCGCCAGAGCAAAGTCTCTATTATTTTTCTACTAAAGAAATAAGGAAGTGAATTTACTTTTTGGGTCCAGAATGACTTTCTCCAAGAATTATAAGATGAAAATTATATATTTTGCCCAGTTACTAAAATGGTACATTAAAAATTCAATTAAGAGAAGAGTCACATTGAGTAAAATAAAAGACTGCAGTTTGTGGGAAGAATTATTTTTCACGGTGCTACTAATCCTGCTGTATCCCGGGTTTTTAATATAAAGGTGTTAAGCTTATTTTGCTTTGTAAGTAAAGAATGTGTATATTGTGAACAGCCTTTTAGCTCAAAATGTTGAGTCATTTACATATGACATAGCATGAATCACTCTTTACAGAAAATGTAGGAAACCCTAGAATACAGACAGCAATATTTTATATTCATGTTTATCAAAGTGAGAGGACTTATATTCCTACATCAAGTTACTACTGAGAGTAAATTTATTTTGAGTTTTATCCCGTAAGTTCTGTTTTGATTTTTTTTAAAAAACAAACCCTTTTAGTCACTTTAATCAGAATTTTAAATGTTCATGTTACATACCAAATTATAATATCTAATGGAGCAATTTGTCTTTTGCTATATTCTCCAAGATTATCTCTTAAGACCATATGCCCCCTGTTTTAATGTTTCTTACATCTTGTTTTTACTCATTTCTGACTGGACAAAGTTCTTCCAAACAATTCTGAGAAACAAAAACACACACGCAGAATTAACAATTCTTTTCCCTGTGCTTCTTATGTAAGAATCCTCCTGTGGCCTCTGCTTGTACAGAACTGGGAAACAACACTTGGTTAGTCTCTTTTAAGTTACAAAAAGCCAATTGATGTTTCTTATTCTTTTTAAATTTTAAATATTTTGTTATAAATACTCACAGGATACCTTATTTCCCTAGCTATCATCTCCTGACTTAATGTTTTTTAAACCCACC