Transcript asmbl_178334

Sequence
Transcript Sequence for observation asmbl_178334 of TGE0058602:
TCTTCTTCTTCTTTTTTTTTTCTTCCACTCTTAAAAAGCTTCTTTCTCTTCACCCAAGCCTCACTGTCCCTCTCCGGCTCTAGCTCTCTCCATATAAACCCTCAAGATTATGTCAATTGGTTAGAGCCAGCCGGGAATTTCGTGCGGGTGCTGAAGGAGCTGCGGGAGCCGGAGAAGAATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCCTACAGGTTTTCAAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATAACATTTTGAAGAATTCCTTTTGTGTTTTAAAATGTGATATATATATATATAAAATTCCTAGGATGCAGTGTCTCATTGTCCCCAACTTTACTACTGCTGCCGTCAATGGTGCTACTATATATGATCAAGATAACATGCTGACTAGTAACCATGAAGATTCAGATGTACCTCAGCAATGCGCCAGAGCAAAGTCTCTATTATTTTTCTACTAAAGAAATAAGGAAGTGAATTTACTTTTTGGGTCCAGAATGACTTTCTCCAAGAATTATAAGATGAAAATTATATATTTTGCCCAGTTACTAAAATGGTACATTAAAAATTCAATTAAGAGAAGAGTCACATTGAGTAAAATAAAAGACTGCAGTTTGTGGGAAGAATTATTTTTCACGGTGCTACTAATCCTGCTGTATCCCGGGTTTTTAATATAAAGGTGTTAAGCTTATTTTGCTTTGTAAGTAAAGAATGTGTATATTGTGAACAGCCTTTTAGCTCAAAATGTTGAGTCATTTACATATGACATAGCATGAATCACTCTTTACAGAAAATGTAGGAAACCCTAGAATACAGACAGCAATATTTTATATTCATGTTTATCAAAGTGAGAGGACTTATATTCCTACATCAAGTTACTACTGAGAGTAAATTTATTTTGAGTTTTATCCCGTAAGTTCTGTTTTGATTTTTTTTAAAAAACAAACCCTTTTAGTCACTTTAATCAGAATTTTAAATGTTCATGTTACATACCAAATTATAATATCTAATGGAGCAATTTGTCTTTTGCTATATTCTCCAAGATTATCTCTTAAGACCATATGCCCCCTGTTTTAATGTTTCTTACATCTTGTTTTTACTCATTTCTGACTGGACAAAGTTCTTCCAAACAATTCTGAGAAACAAAAACACACACGCAGAATTAACAATTCTTTTCCCTGTGCTTCTTATGTAAGAATCCTCCTGTGGCCTCTGCTTGTACAGAACTGGGAAACAACACTTGGTTAGTCTCTTTTAAGTTACAAAAAGCCAATTGATGTTTCTTATTCTTTTTAAATTTTAAATATTTTGTTATAAATACTCACAGGATACCTTATTTCCCTAGCTATCATCTCCTGACTTAATGTTTTTTAAACCCACC