Transcript asmbl_178333

Sequence
Transcript Sequence for observation asmbl_178333 of TGE0058601:
TCTTCTTCTTCTTTTTTTTTTCTTCCACTCTTAAAAAGCTTCTTTCTCTTCACCCAAGCCTCACTGTCCCTCTCCGGCTCTAGCTCTCTCCATATAAACCCTCAAGATTATGTCAATTGGTTAGAGCCAGCCGGGAATTTCGTGCGGGTGCTGAAGGAGCTGCGGGAGCCGGAGAAGAATGAAACTGCGTGGAGTCAGCCTGGCTGCCGGCTTGTTCTTACTGGCCCTGAGTCTTTGGGGGCAGCCTGCAGAGGCTGCGGCTTGCTATGGGTGTTCTCCAGGATCAAAGTGTGACTGCAGTGGCATAAAAGGGGAAAAGGGAGAGAGAGGGTTTCCAGGTTTGGAAGGACACCCAGGATTGCCTGGATTTCCAGGTCCAGAAGGGCCTCCGGGGCCTCGGGGACAAAAGGGTGATGATGGAATTCCAGGGCCACCAGGACCAAAAGGAATCAGAGGTCCTCCTGGACTTCCTGGATTTCCAGGGACACCAGGTCTTCCTGGAATGCCAGGCCACGATGGGGCCCCAGGACCTCAAGGTATTCCCGGATGCAATGGAACCAAGGGAGAACGTGGATTTCCAGGCAGTCCCGGTTTTCCTGGTTTACAGGGTCCTCCAGGACCCCCTGGGATCCCAGGTATGAAGGGTGAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCTGGAATACAAGGCCTACCTGGTCCCACTGGTATACCAGGGCCAATTGGTCCCCCAGGACCACCAGGTTTGATGGGCCCTCCTGGTCCACCAGGACTTCCAGGACCTAAGGGGAATATGGGCTTAAATTTCCAGGGACCCAAAGGTGAAAAAGGTGAGCAAGGTCTTCAGGGCCCACCTGGGCCACCTGGGCAGATCAGTGAACAGAAAAGACCAATTGATGTAGAGTTTCAGAAAGGAGATCAGGGACTTCCTGGTGACCGAGGGCCTCCTGGACCTCCAGGGATACGTGGTCCTCCAGGTCCCCCAGGTGGTGAGAAAGGTGAGAAGGGTGAGCAAGGAGAGCCAGGCAAAAGAGGTAAACCAGGCAAAGATGGAGAAAATGGCCAACCAGGAATTCCTGGTTTGCCTGGTGATCCTGGTTACCCTGGTGAACCCGGAAGGGATGGTGAAAAGGGCCAAAAAGGTGACACTGGCCCACCTGGACCTCCTGGACTTGTAATTCCTAGACCTGGGACTGGTATAACTATAGGAGAAAAAGGAAACATTGGGTTGCCTGGGTTGCCTGGAGAAAAAGGAGAGCGAGGATTTCCTGGAATACAGGGTCCACCTGGCCTTCCTGGACCTCCAGGGGCTGCAGTTATGGGTCCTCCTGGCCCTCCTGGATTTCCTGGAGAAAGGGGTCAGAAAGGTGATGAAGGACCACCTGGAATTTCCATTCCTGGACCTCCTGGACTTGACGGACAGCCTGGGGCTCCTGGGCTTCCAGGGCCTCCTGGCCCTGCTGGCCCTCACATTCCTCCTAGTGATGAGATATGTGAACCAGGCCCTCCAGGCCCCCCAGGATCTCCAGGTGATAAAGGACTCCAAGGAGAACAAGGAGTGAAAGGTGACAAAGGTGACACTTGCTTCAACTGCATTGGAACTGGTATTTCAGGGCCTCCAGGTCAACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGATCTCTTGGTTTCCCTGGACAGAAAGGGGAAAAAGGACAAGCTGGTGCAACTGGTCCCAAAGGATTACCAGGCATTCCAGGAGCTCCAGGTGCTCCAGGCTTTCCTGGATCTAAAGGTGAACCTGGTGATATCCTCACTTTTCCAGGAATGAAGGGTGACAAAGGAGAGTTGGGTTCCCCTGGAGCTCCAGGGCTTCCTGGTTTACCTGGCACTCCTGGACAGGATGGATTGCCAGGGCTTCCTGGCCCGAAAGGAGAGCCTGGTGGAATTACTTTTAAGGGTGAAAGAGGTCCCCCTGGGAACCCAGGTTTACCAGGCCTCCCAGGGAATATAGGGCCTATGGGTCCCCCTGGTTTCGGCCCTCCAGGCCCAGTAGGTGAAAAAGGCATACAAGGTGTGGCAGGAAATCCAGGCCAGCCAGGAATACCAGGTCCTAAAGGGGATCCAGGTCAGACTATAACCCAGCCGGGGAAGCCTGGCTTGCCTGGTAACCCAGGCAGAGATGGTGATGTAGGTCTTCCAGGTGACCCTGGACTTCCAGGGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCTGGAATTGGGCTTCCTGGACCACCTGGTCCCAAAGGCTTTCCTGGAATTCCAGGACCTCCAGGAGCACCTGGGACACCTGGAAGAATTGGTCTAGAAGGCCCTCCTGGGCCACCCGGCTTTCCAGGACCAAAGGGTGAACCAGGATTTGCATTACCTGGGCCACCTGGGCCACCAGGACTTCCAGGTTTCAAAGGAGCACTTGGTCCAAAAGGTGATCGTGGTTTCCCAGGACCTCCGGGTCCTCCAGGACGCACTGGCTTAGATGGGCTCCCTGGACCAAAAGGTGATGTTGGACCAAATGGACAACCTGGACCAATGGGACCTCCTGGGCTGCCAGGAATAGGTGTTCAGGGACCACCAGGACCACCAGGGATTCCTGGGCCAATAGGTCAACCTGGTTTACATGGAATACCAGGAGAGAAGGGGGATCCAGGACCTCCTGGACTTGATGTTCCAGGACCCCCAGGTGAAAGAGGCAGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGACCTCCAGGATCACCAGGGCTTCCAGGAAAAGCAGGTGCCTCTGGATTTCCAGGTGATGATGGCTTGCAGGGTCAGCCAGGACTTCCTGGCCCTACAGGAGAAAAAGGTAGTAAAGGAGAGCCTGGCCTTCCAGGCCCTCCTGGACCAATGGATCCAAATCTTCTGGGCTCAAAAGGAGAGAAGGGGGAACCTGGCTTACCAGGTATACCTGGAGTTTCAGGGCCAAAAGGTTATCAGGGTTTGCCTGGAGACCCAGGGCAACCTGGACTGAGTGGACAACCTGGATTACCAGGACCACCAGGTCCCAAAGGTAACCCTGGTCTCCCTGGACAGCCAGGTCTTATAGGACCTCCTGGACTTAAAGGAACCATCGGTGATATGGGTTTTCCAGGGCCTCAGGGTGTGGAAGGGCCTCCTGGACCTTCTGGAGTTCCTGGACAACCTGGCTCCCCAGGATTACCTGGACAGAAAGGCGACAAAGGTGATCCTGGTATTTCAAGCATTGGTCTTCCAGGTCTTCCTGGTCCAAAGGGTGAGCCTGGTCTGCCTGGATACCCAGGGAACCCTGGTATCAAAGGTTCTGTGGGAGATCCTGGTTTGCCCGGATTACCAGGAACCCCTGGAGCAAAAGGACAACCAGGCCTTCCTGGATTCCCAGGAACCCCAGGCCCTCCTGGACCAAAAGGTATTAGTGGCCCTCCTGGGAACCCCGGCCTTCCAGGAGAACCTGGTCCTGTAGGTGGTGGAGGTCATCCTGGGCAACCAGGGCCTCCAGGCGAAAAAGGCAAACCCGGTCAAGATGGTATTCCTGGACCAGCTGGACAGAAGGGTGAACCAGGTCAACCAGGCTTTGGAAACCCAGGACCCCCTGGACTTCCAGGACTTTCTGGCCAAAAGGGTGATGGAGGATTACCTGGGATTCCAGGAAATCCTGGCCTTCCAGGTCCAAAGGGCGAACCAGGCTTTCACGGTTTCCCTGGTGTGCAGGGTCCCCCAGGCCCTCCTGGTTCTCCGGGTCCAGCTCTGGAAGGACCTAAAGGCAACCCTGGGCCCCAAGGTCCTCCTGGGAGACCAGGTCTACCAGGTCCAGAAGGTCCTCCAGGTCTCCCTGGAAATGGAGGTATTAAAGGAGAGAAGGGAAATCCAGGCCAACCTGGGCTACCTGGCTTGCCTGGTTTGAAAGGAGATCAAGGACCACCAGGACTCCAGGGTAATCCTGGCCGGCCGGGTCTCAATGGAATGAAAGGAGATCCTGGTCTCCCTGGTGTTCCAGGATTCCCAGGCATGAAAGGACCCAGTGGAGTACCTGGATCAGCTGGCCCTGAGGGGGAACCGGGACTTATTGGTCCTCCAGGTCCTCCTGGATTACCTGGTCCTTCAGGACAGAGTATCATAATTAAAGGAGATGCTGGTCCTCCAGGAATCCCTGGCCAGCCTGGGCTAAAGGGTCTACCAGGACCCCAAGGACCTCAAGGCTTACCAGGTCCAACTGGCCCTCCAGGAGATCCTGGACGCAATGGACTCCCTGGCTTTGATGGTGCAGGAGGGCGCAAAGGAGACCCAGGTCTGCCAGGACAGCCAGGTACCCGTGGTTTGGATGGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCAGGTCCCCCTGGAACCTCCTCTGTTGCACATGGATTTCTTATTACACGCCACAGCCAGACAACGGATGCACCACAATGCCCACAGGGAACACTTCAGGTCTATGAAGGCTTTTCTCTCCTGTATGTACAAGGAAATAAAAGAGCCCACGGTCAAGACTTGGGGACGGCTGGCAGCTGCCTTCGTCGCTTTAGTACCATGCCTTTCATGTTCTGCAACATCAATAATGTTTGCAACTTTGCTTCAAGAAATGACTATTCTTACTGGCTCTCTACCCCAGAGCCCATGCCAATGAGCATGCAACCCCTAAAGGGCCAGAGCATCCAGCCATTCATTAGTCGATGTGCAGTATGTGAAGCTCCAGCTGTGGTGATCGCAGTTCACAGTCAGACGATCCAGATTCCCCATTGTCCTCAGGGATGGGATTCTCTGTGGATTGGTTATTCCTTCATGATGCATACAAGTGCAGGGGCAGAAGGCTCAGGTCAAGCCCTAGCCTCCCCTGGTTCCTGCTTGGAAGAGTTTCGTTCAGCTCCCTTCATCGAATGTCATGGGAGGGGTACCTGTAACTACTATGCCAACTCCTACAGCTTTTGGCTGGCAACTGTAGATGTGTCAGACATGTTCAGTAAACCTCAGTCAGAAACGCTGAAAGCAGGAGACTTGAGGACACGAATTAGCCGATGTCAAGTGTGCATGAAGAGGACATAACATTTTGAAGAATTCCTTTTGTGTTTTAAAATGTGATATATATATATATAAAATTCCTAGGATGCAGTGTCTCATTGTCCCCAACTTTACTACTGCTGCCGTCAATGGTGCTACTATATATGATCAAGATAACATGCTGACTAGTAACCATGAAGATTCAGATGTACCTCAGCAATGCGCCAGAGCAAAGTCTCTATTATTTTTCTACTAAAGAAATAAGGAAGTGAATTTACTTTTTGGGTCCAGAATGACTTTCTCCAAGAATTATAAGATGAAAATTATATATTTTGCCCAGTTACTAAAATGGTACATTAAAAATTCAATTAAGAGAAGAGTCACATTGAGTAAAATAAAAGACTGCAGTTTGTGGGAAGAATTATTTTTCACGGTGCTACTAATCCTGCTGTATCCCGGGTTTTTAATATAAAGGTGTTAAGCTTATTTTGCTTTGTAAGTAAAGAATGTGTATATTGTGAACAGCCTTTTAGCTCAAAATGTTGAGTCATTTACATATGACATAGCATGAATCACTCTTTACAGAAAATGTAGGAAACCCTAGAATACAGACAGCAATATTTTATATTCATGTTTATCAAAGTGAGAGGACTTATATTCCTACATCAAGTTACTACTGAGAGTAAATTTATTTTGAGTTTTATCCCGTAAGTTCTGTTTTGATTTTTTTTAAAAAACAAACCCTTTTAGTCACTTTAATCAGAATTTTAAATGTTCATGTTACATACCAAATTATAATATCTAATGGAGCAATTTGTCTTTTGCTATATTCTCCAAGATTATCTCTTAAGACCATATGCCCCCTGTTTTAATGTTTCTTACATCTTGTTTTTACTCATTTCTGACTGGACAAAGTTCTTCCAAACAATTCTGAGAAACAAAAACACACACGCAGAATTAACAATTCTTTTCCCTGTGCTTCTTATGTAAGAATCCTCCTGTGGCCTCTGCTTGTACAGAACTGGGAAACAACACTTGGTTAGTCTCTTTTAAGTTACAAAAAGCCAATTGATGTTTCTTATTCTTTTTAAATTTTAAATATTTTGTTATAAATACTCACAGGATACCTTATTTCCCTAGCTATCATCTCCTGACTTAATGTTTTTTAAACCCACC