Transcript asmbl_178002

Sequence
Transcript Sequence for observation asmbl_178002 of TGE0056124:
AGGATCGGCTCCGCCCCCGGGCTCCCCGGGGGAGTTGATAGAAGGGTCCTTCCCACCCTTTGCCGTCCCCACTCCTGTGCCTACGACCCAGGAGCGTGTCAGCCAAAGCATGGAGAATCAAGAGAAGGCGAGTATCGCGGGCCACATGTTCGACGTAGTCGTGATCGGAGGTGGCATTTCAGGCCAAGAGAAGAGATTGGCATGAACTGTTGCTTTGCCAGTTCCAGCCAGTACCAGCAAAAACATACATGTATGTTGGAGCATCAGAGGAAAGCAGCTCCTGGTGGAGAGACTATCTGCTGCCAAACTCTTGACTGAATATGGCGTTAGTGTTTTGGTTTTAGAAGCTCGGGACAGGGTTGGAGGAAGAACATATACTATAAGGAATGAGCATGTTGATTACGTAGATGTTGGTGGAGCTTATGTGGGACCAACCCAAAACAGAATCTTACGCTTGTCTAAGGAGCTGGGCATAGAGACTTACAAAGTGAATGTCAGTGAGCGTCTCGTTCAATATGTCAAGGGGAAAACATATCCATTTCGGGGCGCCTTTCCACCAGTATGGAATCCCATTGCATATTTGGATTACAATAATCTGTGGAGGACAATAGATAACATGGGGAAGGAGATTCCAACTGATGCACCCTGGGAGGCTCAACATGCTGACAAATGGGACAAAATGACCATGAAAGAGCTCATTGACAAAATCTGCTGGACAAAGACTGCTAGGCGGTTTGCTTATCTTTTTGTGAATATCAATGTGACCTCTGAGCCTCACGAAGTGTCTGCCCTGTGGTTCTTGTGGTATGTGAAGCAGTGCGGGGGCACCACTCGGATATTCTCTGTCACCAATGGTGGCCAGGAACGGAAGTTTGTAGGTGGATCTGGTCAAGTGAGCGAACGGATAATGGACCTCCTCGGAGACCAAGTGAAGCTGAACCATCCTGTCACTCACGTTGACCAGTCAAGTGACAACATCATCATAGAGACGCTGAACCATGAACATTATGAGTGCAAATACGTAATTAATGCGATCCCTCCGACCTTGACTGCCAAGATTCACTTCAGACCAGAGCTTCCAGCAGAGAGAAACCAGTTAATTCAGCGGCTTCCAATGGGAGCTGTCATTAAGTGCATGATGTATTACAAGGAGGCCTTCTGGAAGAAGAAGGATTACTGTGGCTGCATGATCATTGAAGATGAAGATGCTCCAATTTCAATAACCTTGGATGACACCAAGCCAGATGGGTCACTGCCTGCCATCATGGGCTTCATTCTTGCCCGGAAAGCTGATCGACTTGCTAAGCTACATAAGGAAATAAGGAAGAAGAAAATCTGTGAGCTCTATGCCAAAGTGCTGGGATCCCAAGAAGCTTTACATCCAGTGCATTATGAAGAGAAGAACTGGTGTGAGGAGCAGTACTCTGGGGGCTGCTACACGGCCTACTTCCCTCCTGGGATCATGACTCAATATGGAAGGGTGATTCGTCAACCCGTGGGCAGGATTTTCTTTGCGGGCACAGAGACTGCCACAAAGTGGAGCGGCTACATGGAAGGGGCAGTTGAGGCTGGAGAACGAGCAGCTAGGGAGGTCTTAAATGGTCTCGGGAAGGTGACCGAGAAAGATATCTGGGTACAAGAACCTGAATCAAAGGACGTTCCAGCGGTAGAAATCACCCACACCTTCTGGGAAAGGAACCTGCCCTCTGTTTCTGGCCTGCTGAAGATCATTGGATTTTCCACATCAGTAACTGCCCTGGGGTTTGTGCTGTACAAATACAAGCTCCTGCCACGGTCTTGAAGTTCTGTTCTTATGCTCTCTGCTCACTGGTTTTCAATACCACCAAGAGGAAAATATTGACAAGTTTAAAGGCTGTGTCATTGGGCCATGTTTAAGTGTACTGGATTTAACTACCTTTGGCTTAATTCCAATCATTGTTAAAGTAAAAACAATTCAAAGAATCACCTAATTAATTTCAGTAAGATCAAGCTCCATCTTATTTGTCAGTGTAGATCAACTCATGTTAATTGATAGAATAAAGCCTTGTGATCACTTTCTGAAATTCACAAAGTTAAACGTGATGTGCTCATCAGAAACAATTTCTGTGTCCTGTTTTTATTCCCTTCAATGCAAAATACATGATGATTTCAGAAACAAAGCATTTGACTTTCTGTCTGTGGAGGTGGAGTAGGTGAAGGCCCAGCCTGTAACTGTCCTTTTTCTTCCCTTAGGCAATGGTGAACTGTCATTACAGAGCCTAGAGGCTCACAGCCTCCTGGAGGAAGCAGCCTCCACTTTGGATCAGGAAATAGTAAAGGAAAGCAGTGTTGGGGGTAGCGGCATGCAGACCCTCAGACCAGAATGGGGACATCTTGTGGTCTGCTGCCTCAGGAATCTCCTGACCACTTGTAGTCCCTCCGACTTCTCTAGACATCTAGTCTCAGTGCTAGCTTATTTGTATTTTTCCTCTTTCACTTCTTATGGAGGAGAGTGTTTAACTGAGTTAGAATGTTGAAACTGACTTGCTGTGACTTATGTGCAGCTTTCCAGTTGAGCAGAGGAAAATAGTGGCAGGACTGTCCCCCAGGAGGACTCCCTGCTTAGCTCTGTGGGAGACCAACTACGACTGGCATCTTCTCTTCCCCCTGGAAGGCAGCTAGACACCAATGGATCCTTGTCAGTTGTAACATTCTATTTCAACTTCAGGAAAGCAGCAGTTTTCTTTTAATTTTTCCTATGACCATAAAATTAGACATACCTCTCAACTTACATATGTCTTCAACATGGTTACCTCTGCATAAATATTAGCAAAGCATGCCAATTTCTCTTAAGTACTGAAATACATATGATAAATTTGACTGTTATTTGTTGAGACTATCAAACAGAAAAGAAATTAGGGCTCTAATTTCCTTAAAGCAAGCTCACTTGCTTTAGTTGTTAAGTTTTATAAAAGACATGAAATTGAGTCATTTTATATATGAAAACTAAGTTCTCTATCTTAGGAGTAATGTCGGCCCACAAGGGTGCCCACCTCTTGTTTTCCCCTTTTAAAAACTCAGATTTTTAAAAGCCCTTTCCAAAGGTTTCAACTGTAAAATACTTCTTTTTACAATGTATCAACATATTTTTATTTAAGGGGAATTAACAATTGCCAGGGAAACCAGCCAACCCAAGTTTATTATATCATTAACCTTATCATAAATTCAAACCTAAGTTGCTGGACCCTGGTGTGAGGACATAAATCTTCCAAAGTTTTGCCTATCCTAAGAGCTGCATTTTTCTACTGCTCTTTACCTTGCATTTTAGCTAATTTAGGAGTTTTGAGAATGTATTGGATACGCTCCAGTACATAAGGAGTTGCCGCATATTATATCAGACTGCTTTGAGAAATCTCATCCCTAGTCTATTGCAGTTGTTTCTATTAGCTTACTGATTAACTCAGTCCTGACACACCTTTTGGGAAATGCTGATTTAAACTTCTTAACTGGCAACAGTTGGAACAGTAATCAGTTTGCTAACATATTTAAAGTCTTGAATGTTGAAGAACTCATGTGATTTACCCTTTTCAACTTTTTGGAAAACGATTTAATTTATTCTAATTAGATTAACCCTATTAATCTATGGATTGGGTATCAAAATGAATGCCAGTCCAGATGTGCCTAGACACGAAATTGGAGCTGAGGACTCTCACGATATGCAAGTTCATCCAACGTGAAGATACCATAAGCTTTTTCTCTGAACCAGAGAAATGAAAGTCAGTTTAAGAGGCTGATAGATCTTGGCCCTGTTAAGGCATCCACTTCACAGTTCTGAAGGCTGAGTCAGCCCCACTCCACAGTTAGGCCAAGAATTAGATTTTAAAACTTCATCTGTCTGTCCCAGTTAACTGTTAAATAAGGCCTCATCCTCCACTGAAGAGTATGGATTGAAGGATTGTGAACTATGTTTAGTGTGATTGTGAACTTGGTGCCTAATGTTCCATGTCTGAAGTTTGCCCCAGTGCTACACGTTGGAGTATACCTATGTGTGTGCTTTGCCACTGAAGTAAGATTTTGCCTGTATGGTACTGTTTTGTTTGTTAATAAAGTGCACTGCCACCCCCAATGCAGA