Transcript asmbl_178001

Sequence
Transcript Sequence for observation asmbl_178001 of TGE0058600:
AGGATCGGCTCCGCCCCCGGGCTCCCCGGGGGAGTTGATAGAAGGGTCCTTCCCACCCTTTGCCGTCCCCACTCCTGTGCCTACGACCCAGGAGCGTGTCAGCCAAAGCATGGAGAATCAAGAGAAGGCGAGTATCGCGGGCCACATGTTCGACGTAGTCGTGATCGGAGGTGGCATTTCAGGACTATCTGCTGCCAAACTCTTGACTGAATATGGCGTTAGTGTTTTGGTTTTAGAAGCTCGGGACAGGGTTGGAGGAAGAACATATACTATAAGGAATGAGCATGTTGATTACGTAGATGTTGGTGGAGCTTATGTGGGACCAACCCAAAACAGAATCTTACGCTTGTCTAAGGAGCTGGGCATAGAGACTTACAAAGTGAATGTCAGTGAGCGTCTCGTTCAATATGTCAAGGGGAAAACATATCCATTTCGGGGCGCCTTTCCACCAGTATGGAATCCCATTGCATATTTGGATTACAATAATCTGTGGAGGACAATAGATAACATGGGGAAGGAGATTCCAACTGATGCACCCTGGGAGGCTCAACATGCTGACAAATGGGACAAAATGACCATGAAAGAGCTCATTGACAAAATCTGCTGGACAAAGACTGCTAGGCGGTTTGCTTATCTTTTTGTGAATATCAATGTGACCTCTGAGCCTCACGAAGTGTCTGCCCTGTGGTTCTTGTGGTATGTGAAGCAGTGCGGGGGCACCACTCGGATATTCTCTGTCACCAATGGTGGCCAGGAACGGAAGTTTGTAGGTGGATCTGGTCAAGTGAGCGAACGGATAATGGACCTCCTCGGAGACCAAGTGAAGCTGAACCATCCTGTCACTCACGTTGACCAGTCAAGTGACAACATCATCATAGAGACGCTGAACCATGAACATTATGAGTGCAAATACGTAATTAATGCGATCCCTCCGACCTTGACTGCCAAGATTCACTTCAGACCAGAGCTTCCAGCAGAGAGAAACCAGTTAATTCAGCGGCTTCCAATGGGAGCTGTCATTAAGTGCATGATGTATTACAAGGAGGCCTTCTGGAAGAAGAAGGATTACTGTGGCTGCATGATCATTGAAGATGAAGATGCTCCAATTTCAATAACCTTGGATGACACCAAGCCAGATGGGTCACTGCCTGCCATCATGGGCTTCATTCTTGCCCGGAAAGCTGATCGACTTGCTAAGCTACATAAGGAAATAAGGAAGAAGAAAATCTGTGAGCTCTATGCCAAAGTGCTGGGATCCCAAGAAGCTTTACATCCAGTGCATTATGAAGAGAAGAACTGGTGTGAGGAGCAGTACTCTGGGGGCTGCTACACGGCCTACTTCCCTCCTGGGATCATGACTCAATATGGAAGGGTGATTCGTCAACCCGTGGGCAGGATTTTCTTTGCGGGCACAGAGACTGCCACAAAGTGGAGCGGCTACATGGAAGGGGCAGTTGAGGCTGGAGAACGAGCAGCTAGGGAGGTCTTAAATGGTCTCGGGAAGGTGACCGAGAAAGATATCTGGGTACAAGAACCTGAATCAAAGGACGTTCCAGCGGTAGAAATCACCCACACCTTCTGGGAAAGGAACCTGCCCTCTGTTTCTGGCCTGCTGAAGATCATTGGATTTTCCACATCAGTAACTGCCCTGGGGTTTGTGCTGTACAAATACAAGCTCCTGCCACGGTCTTGAAGTTCTGTTCTTATGCTCTCTGCTCACTGGTTTTCAATACCACCAAGAGGAAAATATTGACAAGTTTAAAGGCTGTGTCATTGGGCCATGTTTAAGTGTACTGGATTTAACTACCTTTGGCTTAATTCCAATCATTGTTAAAGTAAAAACAATTCAAAGAATCACCTAATTAATTTCAGTAAGATCAAGCTCCATCTTATTTGTCAGTGTAGATCAACTCATGTTAATTGATAGAATAAAGCCTTGTGATCACTTTCTGAAATTCACAAAGTTAAACGTGATGTGCTCATCAGAAACAATTTCTGTGTCCTGTTTTTATTCCCTTCAATGCAAAATACATGATGATTTCAGAAACAAAGCATTTGACTTTCTGTCTGTGGAGGTGGAGTAGGTGAAGGCCCAGCCTGTAACTGTCCTTTTTCTTCCCTTAGGCAATGGTGAACTGTCATTACAGAGCCTAGAGGCTCACAGCCTCCTGGAGGAAGCAGCCTCCACTTTGGATCAGGAAATAGTAAAGGAAAGCAGTGTTGGGGGTAGCGGCATGCAGACCCTCAGACCAGAATGGGGACATCTTGTGGTCTGCTGCCTCAGGAATCTCCTGACCACTTGTAGTCCCTCCGACTTCTCTAGACATCTAGTCTCAGTGCTAGCTTATTTGTATTTTTCCTCTTTCACTTCTTATGGAGGAGAGTGTTTAACTGAGTTAGAATGTTGAAACTGACTTGCTGTGACTTATGTGCAGCTTTCCAGTTGAGCAGAGGAAAATAGTGGCAGGACTGTCCCCCAGGAGGACTCCCTGCTTAGCTCTGTGGGAGACCAACTACGACTGGCATCTTCTCTTCCCCCTGGAAGGCAGCTAGACACCAATGGATCCTTGTCAGTTGTAACATTCTATTTCAACTTCAGGAAAGCAGCAGTTTTCTTTTAATTTTTCCTATGACCATAAAATTAGACATACCTCTCAACTTACATATGTCTTCAACATGGTTACCTCTGCATAAATATTAGCAAAGCATGCCAATTTCTCTTAAGTACTGAAATACATATGATAAATTTGACTGTTATTTGTTGAGACTATCAAACAGAAAAGAAATTAGGGCTCTAATTTCCTTAAAGCAAGCTCACTTGCTTTAGTTGTTAAGTTTTATAAAAGACATGAAATTGAGTCATTTTATATATGAAAACTAAGTTCTCTATCTTAGGAGTAATGTCGGCCCACAAGGGTGCCCACCTCTTGTTTTCCCCTTTTAAAAACTCAGATTTTTAAAAGCCCTTTCCAAAGGTTTCAACTGTAAAATACTTCTTTTTACAATGTATCAACATATTTTTATTTAAGGGGAATTAACAATTGCCAGGGAAACCAGCCAACCCAAGTTTATTATATCATTAACCTTATCATAAATTCAAACCTAAGTTGCTGGACCCTGGTGTGAGGACATAAATCTTCCAAAGTTTTGCCTATCCTAAGAGCTGCATTTTTCTACTGCTCTTTACCTTGCATTTTAGCTAATTTAGGAGTTTTGAGAATGTATTGGATACGCTCCAGTACATAAGGAGTTGCCGCATATTATATCAGACTGCTTTGAGAAATCTCATCCCTAGTCTATTGCAGTTGTTTCTATTAGCTTACTGATTAACTCAGTCCTGACACACCTTTTGGGAAATGCTGATTTAAACTTCTTAACTGGCAACAGTTGGAACAGTAATCAGTTTGCTAACATATTTAAAGTCTTGAATGTTGAAGAACTCATGTGATTTACCCTTTTCAACTTTTTGGAAAACGATTTAATTTATTCTAATTAGATTAACCCTATTAATCTATGGATTGGGTATCAAAATGAATGCCAGTCCAGATGTGCCTAGACACGAAATTGGAGCTGAGGACTCTCACGATATGCAAGTTCATCCAACGTGAAGATACCATAAGCTTTTTCTCTGAACCAGAGAAATGAAAGTCAGTTTAAGAGGCTGATAGATCTTGGCCCTGTTAAGGCATCCACTTCACAGTTCTGAAGGCTGAGTCAGCCCCACTCCACAGTTAGGCCAAGAATTAGATTTTAAAACTTCATCTGTCTGTCCCAGTTAACTGTTAAATAAGGCCTCATCCTCCACTGAAGAGTATGGATTGAAGGATTGTGAACTATGTTTAGTGTGATTGTGAACTTGGTGCCTAATGTTCCATGTCTGAAGTTTGCCCCAGTGCTACACGTTGGAGTATACCTATGTGTGTGCTTTGCCACTGAAGTAAGATTTTGCCTGTATGGTACTGTTTTGTTTGTTAATAAAGTGCACTGCCACCCCCAATGCAGA