Transcript asmbl_17574

Sequence
Transcript Sequence for observation asmbl_17574 of TGE0058599:
GCGGCCTCGGGAGCGGGATCAGACGCGCAGAGGAGGCGGGGCCGCGGCTGGTTTCCTGCCGGGGGGCGGCTCTGGGCCGCCGAGTCCCCTCCTCCCGCCCCTGAGGAGGAGGAGCCGCCGCCACCCGCCGCGCCCGACACCCGGGAGGCCCCGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCGGACGCCGCGCGGAAAAGATGAATTTACAACCAATTTTCTGGATTGGACTGATCAGTTCAGTTTGCTGTGTGTTTGCTCAAACAGATGAAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGGAGAATGTATACAAGCAGGGCCAAATTGTGGGTGGTGCACAAATTCAACATTTTTACAGGAAGGAATGCCTACTTCTGCACGATGTGATGATTTAGAAGCCTTAAAAAAGAAGGGTTGCCCTCCAGATGACATAGAAAATCCCAGAGGCTCCAAAGATATAAAGAAAAATAAAAATGTAACCAACCGTAGCAAAGGAACAGCAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAGCTAAGCTCAGGAACCCTTGCACAAGTGAACAGAACTGCACCAGCCCATTTAGCTACAAAAATGTGCTCAGTCTTACTAATAAAGGAGAAGTATTTAATGAACTTGTTGGAAAACAGCGCATATCTGGAAATTTGGATTCTCCAGAAGGTGGTTTCGATGCCATCATGCAAGTTGCAGTTTGTGGATCACTGATTGGCTGGAGGAATGTTACACGGCTGCTGGTGTTTTCCACAGATGCCGGGTTTCACTTTGCTGGAGATGGGAAACTTGGTGGCATTGTTTTACCAAATGATGGACAATGTCACCTGGAAAATAATATGTACACAATGAGCCATTATTATGATTATCCTTCTATTGCTCACCTTGTCCAGAAACTGAGTGAAAATAATATTCAGACAATTTTTGCAGTTACTGAAGAATTTCAGCCTGTTTACAAGGAGCTGAAAAACTTGATCCCTAAGTCAGCAGTAGGAACATTATCTGCAAATTCTAGCAATGTAATTCAGTTGATCATTGATGCATACAATTCCCTTTCCTCAGAAGTCATTTTGGAAAACGGCAAATTGTCAGAAGGCGTAACAATAAGTTACAAATCTTACTGCAAGAACGGGGTGAATGGAACAGGGGAAAATGGAAGAAAATGTTCCAATATTTCCATTGGAGATGAGGTTCAATTTGAAATTAGCATAACTTCAAATAAGTGTCCAAAAAAGGATTCTGACAGCTTTAAAATTAGGCCTCTGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACGGACAGATCTGCAATGGCCGGGGCATCTGCGAGTGTGGTGTCTGTAAGTGTACAGATCCGAAGTTTCAAGGGCAAACGTGTGAGATGTGTCAGACCTGCCTTGGTGTCTGTGCTGAGCATAAAGAATGTGTTCAGTGCAGAGCCTTCAATAAAGGAGAAAAGAAAGACACATGCACACAGGAATGTTCCTATTTTAACATTACCAAGGTAGAAAGTCGGGACAAATTACCCCAGCCGGTCCAACCTGATCCTGTGTCCCATTGTAAGGAGAAGGATGTTGACGACTGTTGGTTCTATTTTACGTATTCAGTGAATGGGAACAACGAGGTCATGGTTCATGTTGTGGAGAATCCAGAGTGTCCCACTGGTCCAGACATCATTCCAATTGTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGGTAAGTTACAAAACATCCAAAAAGCAAAGTGGCTTATAAAGTAAATGTAATACTCCTAAGACTTATGTATTAGCTGTCAGGCTGATTATTAAAGTCCTTTCTAAGTATTTTATTCCCCCAAAAGTTTCTTACTCAAGGAATTTGCATTTAGTGAAAAACAGAAAGCATCCTAAATATATCCCATTGAAACAAAACATTGATTATAAGCATGTATATTCTGGTTACTGTGGCCAGTATTTTTATTTCTTTAATAGTTTTGATCCTAAATCTGCCTTTTCATCTAATGTGAAGTAGAATCCTAAATAATGTTATCTGTGTAGCAAGCTATTCAATGGAAAGCTGCTTCTTTCTTTAAAACAAACAAA