Transcript asmbl_17573

Sequence
Transcript Sequence for observation asmbl_17573 of TGE0058598:
TTTTCATTATTTTCTCTCTGACACTTCACATAAAATGTTCTGTTCTTTCTTCTTTCTGACAGATGAAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGGAGAATGTATACAAGCAGGGCCAAATTGTGGGTGGTGCACAAATTCAACATTTTTACAGGAAGGAATGCCTACTTCTGCACGATGTGATGATTTAGAAGCCTTAAAAAAGAAGGGTTGCCCTCCAGATGACATAGAAAATCCCAGAGGCTCCAAAGATATAAAGAAAAATAAAAATGTAACCAACCGTAGCAAAGGAACAGCAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAGCTAAGCTCAGGAACCCTTGCACAAGTGAACAGAACTGCACCAGCCCATTTAGCTACAAAAATGTGCTCAGTCTTACTAATAAAGGAGAAGTATTTAATGAACTTGTTGGAAAACAGCGCATATCTGGAAATTTGGATTCTCCAGAAGGTGGTTTCGATGCCATCATGCAAGTTGCAGTTTGTGGATCACTGATTGGCTGGAGGAATGTTACACGGCTGCTGGTGTTTTCCACAGATGCCGGGTTTCACTTTGCTGGAGATGGGAAACTTGGTGGCATTGTTTTACCAAATGATGGACAATGTCACCTGGAAAATAATATGTACACAATGAGCCATTATTATGATTATCCTTCTATTGCTCACCTTGTCCAGAAACTGAGTGAAAATAATATTCAGACAATTTTTGCAGTTACTGAAGAATTTCAGCCTGTTTACAAGGAGCTGAAAAACTTGATCCCTAAGTCAGCAGTAGGAACATTATCTGCAAATTCTAGCAATGTAATTCAGTTGATCATTGATGCATACAATTCCCTTTCCTCAGAAGTCATTTTGGAAAACGGCAAATTGTCAGAAGGCGTAACAATAAGTTACAAATCTTACTGCAAGAACGGGGTGAATGGAACAGGGGAAAATGGAAGAAAATGTTCCAATATTTCCATTGGAGATGAGGTTCAATTTGAAATTAGCATAACTTCAAATAAGTGTCCAAAAAAGGATTCTGACAGCTTTAAAATTAGGCCTCTGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACGGACAGATCTGCAATGGCCGGGGCATCTGCGAGTGTGGTGTCTGTAAGTGTACAGATCCGAAGTTTCAAGGGCAAACGTGTGAGATGTGTCAGACCTGCCTTGGTGTCTGTGCTGAGCATAAAGAATGTGTTCAGTGCAGAGCCTTCAATAAAGGAGAAAAGAAAGACACATGCACACAGGAATGTTCCTATTTTAACATTACCAAGGTAGAAAGTCGGGACAAATTACCCCAGCCGGTCCAACCTGATCCTGTGTCCCATTGTAAGGAGAAGGATGTTGACGACTGTTGGTTCTATTTTACGTATTCAGTGAATGGGAACAACGAGGTCATGGTTCATGTTGTGGAGAATCCAGAGTGTCCCACTGGTCCAGACATCATTCCAATTGTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTTCCATAGTCACAGTTAGGTAGCTTTAGGGCAATATTGCCATGGTTTTACTCATGTGCAGGTTTTGAAAATGTACAATATGTATAATTTTTAAAATGTTTTATTATTTTGAAAATAATGTTGTAATTCATGCCAGGGACTGACAAAAGACTTGAGACAGGATGGTTACTCTTGTCAGCTAAGGTCACATTGTGCCTTTTTGACCTTTTCTTCCTGGACTATTGAAATCAAGCTTATTGGATTAAGTGATATTTCTATAGCGATTGAAAGGGCAATAGTTAAAGTAATGAGCATGATGAGAGTTTCTGTTAATCATGTATTAAAACTGATTTTTAGCTTTACAAATATGTCAGTTTGCAGTTATGCAGAATCCAAAGTAAATGTCCTGCTAGCTAGTTAAGGATTGTTTTAAATCTGTTATTTTGCTATTTGCCTGTTAGACATGACTGATGACATATCTGAAAGACAAGTATGTTGAGAGTTGCTGGTGTAAAATACGTTTGAAATAGTTGATCTACAAAGGCCATGGGAAAAATTCAGAGAGTTAGGAAGGAAAAACCAATAGCTTTAAAACCTGTGTGCCATTTTAAGAGTTACTTAATGTTTGGTAACTTTTATGCCTTCACTTTACAAATTCAAGCCTTAGATAAAAGAACCGAGCAATTTTCTGCTAAAAAGTCCTTGATTTAGCACTATTTACATACAGGCCATACTTTACAAAGTATTTGCTGAATGGGGACCTTTTGAGTTGAATTTATTTTATTATTTTTATTTTGTTTAATGTCTGGTGCTTTCTGTCACCTCTTCTAATCTTTTAATGTATTTGTTTGCAATTTTGGGGTAAGACTTTTTTTATGAGTACTTTTTCTTTGAAGTTTTAGCGGTCAATTTGCCTTTTTAATGAACATGTGAAGTTATACTGTGGCTATGCAACAGCTCTCACCTACGCGAGTCTTACTTTGAGTTAGTGCCATAACAGACCACTGTATGTTTACTTCTCACCATTTGAGTTGCCCATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTGCTATTTACTGAAGTTATTTATTAAATATGCCTAAAATACTTAAATCGGATGTCTTGACTCTGATGTATTTTATCAGGTTGTGTGCATGAAATTTTTATAGATTAAAGAAGTTGAGGAAAAGC