Transcript asmbl_17572

Sequence
Transcript Sequence for observation asmbl_17572 of TGE0058597:
GCGGCCTCGGGAGCGGGATCAGACGCGCAGAGGAGGCGGGGCCGCGGCTGGTTTCCTGCCGGGGGGCGGCTCTGGGCCGCCGAGTCCCCTCCTCCCGCCCCTGAGGAGGAGGAGCCGCCGCCACCCGCCGCGCCCGACACCCGGGAGGCCCCGCCAGCCCGCGGGAGAGGCCCAGCGGGAGTCGCGGAACAGCAGGCCCGAGCCCACCGCGCCGGGCCCCGGACGCCGCGCGGAAAAGATGAATTTACAACCAATTTTCTGGATTGGACTGATCAGTTCAGTTTGCTGTGTGTTTGCTCAAACAGATGAAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGGAGAATGTATACAAGCAGGGCCAAATTGTGGGTGGTGCACAAATTCAACATTTTTACAGGAAGGAATGCCTACTTCTGCACGATGTGATGATTTAGAAGCCTTAAAAAAGAAGGGTTGCCCTCCAGATGACATAGAAAATCCCAGAGGCTCCAAAGATATAAAGAAAAATAAAAATGTAACCAACCGTAGCAAAGGAACAGCAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAGCTAAGCTCAGGAACCCTTGCACAAGTGAACAGAACTGCACCAGCCCATTTAGCTACAAAAATGTGCTCAGTCTTACTAATAAAGGAGAAGTATTTAATGAACTTGTTGGAAAACAGCGCATATCTGGAAATTTGGATTCTCCAGAAGGTGGTTTCGATGCCATCATGCAAGTTGCAGTTTGTGGATCACTGATTGGCTGGAGGAATGTTACACGGCTGCTGGTGTTTTCCACAGATGCCGGGTTTCACTTTGCTGGAGATGGGAAACTTGGTGGCATTGTTTTACCAAATGATGGACAATGTCACCTGGAAAATAATATGTACACAATGAGCCATTATTATGATTATCCTTCTATTGCTCACCTTGTCCAGAAACTGAGTGAAAATAATATTCAGACAATTTTTGCAGTTACTGAAGAATTTCAGCCTGTTTACAAGGAGCTGAAAAACTTGATCCCTAAGTCAGCAGTAGGAACATTATCTGCAAATTCTAGCAATGTAATTCAGTTGATCATTGATGCATACAATTCCCTTTCCTCAGAAGTCATTTTGGAAAACGGCAAATTGTCAGAAGGCGTAACAATAAGTTACAAATCTTACTGCAAGAACGGGGTGAATGGAACAGGGGAAAATGGAAGAAAATGTTCCAATATTTCCATTGGAGATGAGGTTCAATTTGAAATTAGCATAACTTCAAATAAGTGTCCAAAAAAGGATTCTGACAGCTTTAAAATTAGGCCTCTGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACGGACAGATCTGCAATGGCCGGGGCATCTGCGAGTGTGGTGTCTGTAAGTGTACAGATCCGAAGTTTCAAGGGCAAACGTGTGAGATGTGTCAGACCTGCCTTGGTGTCTGTGCTGAGCATAAAGAATGTGTTCAGTGCAGAGCCTTCAATAAAGGAGAAAAGAAAGACACATGCACACAGGAATGTTCCTATTTTAACATTACCAAGGTAGAAAGTCGGGACAAATTACCCCAGCCGGTCCAACCTGATCCTGTGTCCCATTGTAAGGAGAAGGATGTTGACGACTGTTGGTTCTATTTTACGTATTCAGTGAATGGGAACAACGAGGTCATGGTTCATGTTGTGGAGAATCCAGAGTGTCCCACTGGTCCAGACATCATTCCAATTGTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTTCCATAGTCACAGTTAGGTAGCTTTAGGGCAATATTGCCATGGTTTTACTCATGTGCAGGTTTTGAAAATGTACAATATGTATAATTTTTAAAATGTTTTATTATTTTGAAAATAATGTTGTAATTCATGCCAGGGACTGACAAAAGACTTGAGACAGGATGGTTACTCTTGTCAGCTAAGGTCACATTGTGCCTTTTTGACCTTTTCTTCCTGGACTATTGAAATCAAGCTTATTGGATTAAGTGATATTTCTATAGCGATTGAAAGGGCAATAGTTAAAGTAATGAGCATGATGAGAGTTTCTGTTAATCATGTATTAAAACTGATTTTTAGCTTTACAAATATGTCAGTTTGCAGTTATGCAGAATCCAAAGTAAATGTCCTGCTAGCTAGTTAAGGATTGTTTTAAATCTGTTATTTTGCTATTTGCCTGTTAGACATGACTGATGACATATCTGAAAGACAAGTATGTTGAGAGTTGCTGGTGTAAAATACGTTTGAAATAGTTGATCTACAAAGGCCATGGGAAAAATTCAGAGAGTTAGGAAGGAAAAACCAATAGCTTTAAAACCTGTGTGCCATTTTAAGAGTTACTTAATGTTTGGTAACTTTTATGCCTTCACTTTACAAATTCAAGCCTTAGATAAAAGAACCGAGCAATTTTCTGCTAAAAAGTCCTTGATTTAGCACTATTTACATACAGGCCATACTTTACAAAGTATTTGCTGAATGGGGACCTTTTGAGTTGAATTTATTTTATTATTTTTATTTTGTTTAATGTCTGGTGCTTTCTGTCACCTCTTCTAATCTTTTAATGTATTTGTTTGCAATTTTGGGGTAAGACTTTTTTTATGAGTACTTTTTCTTTGAAGTTTTAGCGGTCAATTTGCCTTTTTAATGAACATGTGAAGTTATACTGTGGCTATGCAACAGCTCTCACCTACGCGAGTCTTACTTTGAGTTAGTGCCATAACAGACCACTGTATGTTTACTTCTCACCATTTGAGTTGCCCATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTGCTATTTACTGAAGTTATTTATTAAATATGCCTAAAATACTTAAATCGGATGTCTTGACTCTGATGTATTTTATCAGGTTGTGTGCATGAAATTTTTATAGATTAAAGAAGTTGAGGAAAAGC