Transcript asmbl_17571

Sequence
Transcript Sequence for observation asmbl_17571 of TGE0056474:
ACCTGATCAGAGAAGCAGTTTGATGTACTAAAGGCTTCTCGATTGGGAGACAGGAAACCTGGGTGTCAGTGCCGGGTCTGCCACTGAATTTCTGTGTGACCTTTGTCAGAGTACTGTACTTCCAGAGCGTTGGTTTCCACATCTACCCTATAAAGCAGCCTGCATGTTTCTCTCATTCTCTCGTTCGAGGAGTTGGAGGATAGCTGCTGCCTGATATGAATTTACAACCAATTTTCTGGATTGGACTGATCAGTTCAGTTTGCTGTGTGTTTGCTCAAACAGATGAAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGGAGAATGTATACAAGCAGGGCCAAATTGTGGGTGGTGCACAAATTCAACATTTTTACAGGAAGGAATGCCTACTTCTGCACGATGTGATGATTTAGAAGCCTTAAAAAAGAAGGGTTGCCCTCCAGATGACATAGAAAATCCCAGAGGCTCCAAAGATATAAAGAAAAATAAAAATGTAACCAACCGTAGCAAAGGAACAGCAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAGCTAAGCTCAGGAACCCTTGCACAAGTGAACAGAACTGCACCAGCCCATTTAGCTACAAAAATGTGCTCAGTCTTACTAATAAAGGAGAAGTATTTAATGAACTTGTTGGAAAACAGCGCATATCTGGAAATTTGGATTCTCCAGAAGGTGGTTTCGATGCCATCATGCAAGTTGCAGTTTGTGGATCACTGATTGGCTGGAGGAATGTTACACGGCTGCTGGTGTTTTCCACAGATGCCGGGTTTCACTTTGCTGGAGATGGGAAACTTGGTGGCATTGTTTTACCAAATGATGGACAATGTCACCTGGAAAATAATATGTACACAATGAGCCATTATTATGATTATCCTTCTATTGCTCACCTTGTCCAGAAACTGAGTGAAAATAATATTCAGACAATTTTTGCAGTTACTGAAGAATTTCAGCCTGTTTACAAGGAGCTGAAAAACTTGATCCCTAAGTCAGCAGTAGGAACATTATCTGCAAATTCTAGCAATGTAATTCAGTTGATCATTGATGCATACAATTCCCTTTCCTCAGAAGTCATTTTGGAAAACGGCAAATTGTCAGAAGGCGTAACAATAAGTTACAAATCTTACTGCAAGAACGGGGTGAATGGAACAGGGGAAAATGGAAGAAAATGTTCCAATATTTCCATTGGAGATGAGGTTCAATTTGAAATTAGCATAACTTCAAATAAGTGTCCAAAAAAGGATTCTGACAGCTTTAAAATTAGGCCTCTGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACGGACAGATCTGCAATGGCCGGGGCATCTGCGAGTGTGGTGTCTGTAAGTGTACAGATCCGAAGTTTCAAGGGCAAACGTGTGAGATGTGTCAGACCTGCCTTGGTGTCTGTGCTGAGCATAAAGAATGTGTTCAGTGCAGAGCCTTCAATAAAGGAGAAAAGAAAGACACATGCACACAGGAATGTTCCTATTTTAACATTACCAAGGTAGAAAGTCGGGACAAATTACCCCAGCCGGTCCAACCTGATCCTGTGTCCCATTGTAAGGAGAAGGATGTTGACGACTGTTGGTTCTATTTTACGTATTCAGTGAATGGGAACAACGAGGTCATGGTTCATGTTGTGGAGAATCCAGAGTGTCCCACTGGTCCAGACATCATTCCAATTGTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTTCCATAGTCACAGTTAGGTAGCTTTAGGGCAATATTGCCATGGTTTTACTCATGTGCAGGTTTTGAAAATGTACAATATGTATAATTTTTAAAATGTTTTATTATTTTGAAAATAATGTTGTAATTCATGCCAGGGACTGACAAAAGACTTGAGACAGGATGGTTACTCTTGTCAGCTAAGGTCACATTGTGCCTTTTTGACCTTTTCTTCCTGGACTATTGAAATCAAGCTTATTGGATTAAGTGATATTTCTATAGCGATTGAAAGGGCAATAGTTAAAGTAATGAGCATGATGAGAGTTTCTGTTAATCATGTATTAAAACTGATTTTTAGCTTTACAAATATGTCAGTTTGCAGTTATGCAGAATCCAAAGTAAATGTCCTGCTAGCTAGTTAAGGATTGTTTTAAATCTGTTATTTTGCTATTTGCCTGTTAGACATGACTGATGACATATCTGAAAGACAAGTATGTTGAGAGTTGCTGGTGTAAAATACGTTTGAAATAGTTGATCTACAAAGGCCATGGGAAAAATTCAGAGAGTTAGGAAGGAAAAACCAATAGCTTTAAAACCTGTGTGCCATTTTAAGAGTTACTTAATGTTTGGTAACTTTTATGCCTTCACTTTACAAATTCAAGCCTTAGATAAAAGAACCGAGCAATTTTCTGCTAAAAAGTCCTTGATTTAGCACTATTTACATACAGGCCATACTTTACAAAGTATTTGCTGAATGGGGACCTTTTGAGTTGAATTTATTTTATTATTTTTATTTTGTTTAATGTCTGGTGCTTTCTGTCACCTCTTCTAATCTTTTAATGTATTTGTTTGCAATTTTGGGGTAAGACTTTTTTTATGAGTACTTTTTCTTTGAAGTTTTAGCGGTCAATTTGCCTTTTTAATGAACATGTGAAGTTATACTGTGGCTATGCAACAGCTCTCACCTACGCGAGTCTTACTTTGAGTTAGTGCCATAACAGACCACTGTATGTTTACTTCTCACCATTTGAGTTGCCCATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTGCTATTTACTGAAGTTATTTATTAAATATGCCTAAAATACTTAAATCGGATGTCTTGACTCTGATGTATTTTATCAGGTTGTGTGCATGAAATTTTTATAGATTAAAGAAGTTGAGGAAAAGC