Transcript asmbl_174209

Sequence
Transcript Sequence for observation asmbl_174209 of TGE0058596:
GGATCGGCAGTTGGGAGAGACTCGGAGGCCCGATGGCTCCTGTTTTCTGCCTGTGACAGGTGATCACCCCCGAGGAGATTGTGGACCCCAACGTGGACGAGCACTCTGTCATGACCTACCTGTCCCAGTTCCCCAAGGCCAAGCTGAAGCCAGGGGCTCCCTTGCGGCCCAAACTGAACCCGAAGAAAGCCCGTGCCTACGGGCCAGGCATCGAGCCCACAGGCAACATGGTGAAGAAGCGGGCAGAGTTCACTGTGGAGACCAGAAGTGCTGGCCAGGGAGAGGTGCTGGTGTACGTGGAGGACCCGGCCGGACACCAGGAGGAGGCAAAAGTGACCGCCAATAACGACAAGAACCGCACCTTCTCCGTCTGGTACGTCCCCGAGGTGACGGGGACTCATAAGGTTACTGTGCTCTTTGCTGGCCAGCACATCGCCAAGAGCCCCTTCGAGGTGTACGTGGATAAGTCACAGGGTGACGCCAGCAAAGTGACAGCCCAAGGTCCCGGCCTGGAGCCCAGTGGCAACATCGCCAACAAGACCACCTACTTTGAGATCTTTACGGCAGGAGCTGGCACGGGCGAGGTCGAGGTTGTGATCCAGGACCCCATGGGACAGAAGGGCACGGTAGAGCCTCAGCTGGAGGCCCGGGGCGACAGCACATACCGCTGCAGCTACCAGCCCACCATGGAGGGCGTCCACACCGTGCACGTCACGTTTGCCGGCGTGCCCATCCCTCGCAGCCCCTACACTGTCACTGTTGGCCAAGCCTGTAACCCGAGTGCCTGCCGGGCGGTTGGCCGGGGCCTCCAGCCCAAGGGTGTGCGGGTGAAGGAGACAGCTGACTTCAAGGTGTACACAAAGGGCGCTGGCAGTGGGGAGCTGAAGGTCACCGTGAAGGGCCCCAAGGGAGAGGAGCGCGTGAAGCAGAAGGACCTGGGGGATGGCGTGTATGGCTTCGAGTATTACCCCATGGTCCCTGGAACCTATATCGTCACCATCACGTGGGGTGGTCAGAACATCGGGCGCAGTCCCTTCGAAGTGAAGGTGGGCACCGAGTGTGGCAATCAGAAGGTACGGGCCTGGGGCCCTGGGCTGGAGGGCGGCGTCGTTGGCAAGTCAGCAGACTTTGTGGTGGAGGCTATCGGGGACGACGTGGGCACGCTGGGCTTCTCGGTGGAAGGGCCATCGCAGGCTAAGATCGAATGTGACGACAAGGGCGACGGCTCCTGTGATGTGCGCTACTGGCCGCAGGAGGCTGGCGAGTATGCCGTTCACGTGCTGTGCAACAGCGAAGACATCCGCCTCAGCCCCTTCATGGCTGACATCCGTGACGCGCCCCAGGACTTCCACCCAGACAGGGTGAAGGCACGTGGGCCTGGATTGGAGAAGACAGGTGTGGCCGTCAACAAGCCAGCAGAGTTCACAGTGGATGCCAAGCACGGTGGCAAGGCCCCACTTCGGGTCCAAGTCCAGGACAATGAAGGCTGCCCTGTGGAGGCGTTGGTCAAGGACAACGGCAATGGCACTTACAGCTGCTCCTACGTGCCCAGGAAGCCGGTGAAGCACACAGCCATGGTGTCCTGGGGAGGCGTCAGCATCCCCAACAGCCCCTTCAGGGTGAATGTGGGAGCTGGCAGCCACCCCAACAAGGTCAAAGTATACGGCCCCGGAGTAGCCAAGACAGGGCTCAAGGCCCACGAGCCCACCTACTTCACTGTGGACTGCGCCGAGGCTGGCCAGGGGGACGTCAGCATCGGCATCAAGTGTGCCCCTGGAGTGGTAGGCCCCGCCGAAGCTGACATCGACTTCGACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGGCTGGCAGCTACACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCCCATCCGAGTCAAGGTGGAGCCCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGCCCTGGCCTCAGTCGCACTGGTGTCGAGCTTGGCAAGCCCACCCACTTCACAGTAAATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTCTCAGGACTCACCAAGGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTACACAGTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAGGGGATCCCATCCCTAAGAGCCCTTTCTCAGTGGCAGTATCTCCAAGCCTGGACCTCAGCAAGATCAAGGTGTCTGGCCTGGGAGAGAAGGTGGACGTTGGCAAAGACCAGGAGTTCACAGTCAAATCAAAGGGTGCTGGTGGTCAAGGCAAAGTGGCATCCAAGATTGTGGGCCCCTCGGGTGCAGCGGTGCCCTGCAAGGTGGAGCCAGGCCTGGGGGCTGACAACAGTGTGGTGCGCTTCCTGCCCCGTGAGGAAGGGCCCTATGAGGTGGAGGTGACCTATGACGGCGTGCCCGTGCCTGGCAGCCCCTTTCCTCTGGAAGCTGTGGCCCCCACCAAGCCTAGCAAGGTGAAGGCGTTTGGGCCGGGGCTGCAGGGAGGCAGTGCGGGCTCCCCCGCCCGCTTCACCATCGACACCAAGGGCGCCGGCACAGGTGGCCTGGGCCTGACGGTGGAGGGCCCCTGTGAGGCGCAGCTCGAGTGCTTGGACAATGGGGATGGCACATGTTCCGTGTCCTACGTGCCCACCGAGCCCGGGGACTACAACATCAACATCCTCTTCGCTGACACCCACATCCCTGGCTCCCCATTCAAGGCCCACGTGGTTCCCTGCTTTGACGCATCCAAAGTCAAGTGCTCAGGCCCCGGGCTGGAGCGGGCCACCGCTGGGGAGGTGGGCCAATTCCAAGTGGACTGCTCGAGCGCGGGCAGCGCGGAGCTGACCATTGAGATCTGCTCGGAGGCGGGGCTTCCGGCCGAGGTGTACATCCAGGACCACGGTGATGGCACGCACACCATTACCTACATTCCCCTCTGCCCCGGGGCCTACACCGTCACCATCAAGTACGGCGGCCAGCCCGTGCCCAACTTCCCCAGCAAGCTGCAGGTGGAACCTGCGGTGGACACTTCCGGTGTCCAGTGCTATGGGCCTGGTATTGAGGGCCAGGGTGTCTTCCGTGAGGCCACCACTGAGTTCAGTGTGGACGCCCGGGCTCTGACACAGACCGGAGGGCCGCACGTCAAGGCCCGTGTGGCCAACCCCTCAGGCAACCTGACGGAGACCTACGTTCAGGACCGTGGCGATGGCATGTACAAAGTGGAGTACACGCCTTACGAGGAGGGACTGCACTCCGTGGACGTGACCTATGACGGCAGTCCCGTGCCCAGCAGCCCCTTCCAGGTGCCCGTGACCGAGGGCTGCGACCCCTCCCGGGTGCGTGTCCACGGGCCAGGCATCCAAAGTGGCACCACCAACAAGCCCAACAAGTTCACTGTGGAGACCAGGGGAGCTGGCACGGGCGGCCTGGGCCTGGCTGTAGAGGGCCCCTCCGAGGCCAAGATGTCCTGCATGGATAACAAGGACGGCAGCTGCTCGGTCGAGTACATCCCTTATGAGGCTGGCACCTACAGCCTCAACGTCACCTATGGTGGCCATCAAGTGCCAGGCAGTCCTTTCAAGGTCCCTGTGCATGATGTGACAGATGCGTCCAAGGTCAAGTGCTCTGGGCCCGGCCTGAGCCCAGGCATGGTTCGTGCCAACCTCCCTCAGTCCTTCCAGGTGGACACAAGCAAGGCTGGTGTGGCCCCATTGCAGGTCAAAGTGCAAGGGCCCAAAGGCCTGGTGGAGCCAGTGGACGTGGTAGACAACGCTGATGGCACCCAGACCGTCAATTATGTGCCCAGCCGAGAAGGGCCCTACAGCATCTCAGTACTGTATGGAGATGAAGAGGTACCCCGGAGCCCCTTCAAGGTCAAGGTGCTGCCTACTCATGATGCCAGCAAGGTGAAGGCCAGTGGCCCCGGGCTCAACACCACTGGCGTGCCTGCCAGCCTGCCCGTGGAGTTCACCATCGATGCAAAGGACGCCGGGGAGGGCCTGCTGGCTGTCCAGATCACGGATCCCGAAGGCAAGCCGAAGAAGACACACATCCAAGACAACCATGACGGCACGTATACAGTGGCCTACGTGCCAGACGTGACAGGTCGCTACACCATCCTCATCAAGTACGGTGGTGACGAGATCCCCTTCTCCCCGTACCGCGTGCGTGCCGTGCCCACCGGGGACGCCAGCAAGTGCACTGTCACAGGTGCTGGCATCGGCCCCACCATTCAGATTGGGGAGGAGACGGTGATCACTGTGGACACTAAGGCGGCAGGCAAAGGCAAAGTGACGTGCACCGTGTGCACGCCTGATGGCTCAGAGGTGGATGTGGACGTGGTGGAGAATGAGGACGGCACTTTCGACATCTTCTACACGGCCCCCCAGCCGGGCAAATACGTCATCTGTGTGCGCTTTGGTGGCGAGCACGTGCCCAACAGCCCCTTCCAAGTGACGGCTCTGGCTGGGGACCAGCCCTCGGTGCAGCCCCCTCTACGGTCTCAGCAGCTGGCCCCACAGTACACCTACGCCCAGGGCGGCCAGCAGACTTGGGCCCCGGAGAGGCCCCTGGTGGGTGTCAATGGGCTGGATGTGACCAGCCTGAGGCCCTTTGACCTTGTCATCCCCTTCACCATCAAGAAGGGCGAGATCACAGGGGAGGTTCGGATGCCCTCAGGCAAGGTGGCGCAGCCCACCATCACTGACAACAAAGACGGCACCGTGACCGTGCGGTATGCACCCAGCGAGGCTGGCCTGCACGAGATGGACATCCGCTATGACAACATGCACATCCCAGGAAGCCCCTTGCAGTTCTATGTGGATTACGTCAACTGTGGCCATGTCACTGCCTATGGGCCTGGCCTCACCCATGGAGTAGTGAACAAGCCTGCCACCTTCACCGTCAACACCAAGGATGCAGGAGAGGGGGGCCTGTCTCTGGCCATTGAGGGCCCGTCCAAAGCAGAAATCAGCTGCACTGACAACCAGGATGGGACATGCAGCGTGTCCTACCTGCCTGTGCTGCCGGGGGACTACAGCATTCTAGTCAAGTACAATGAACAGCACGTCCCAGGCAGCCCCTTCACTGCTCGGGTCACAGGTGACGACTCCATGCGTATGTCCCACCTAAAGGTCGGCTCTGCTGCCGACATCCCCATCAACATCTCAGAGACGGATCTCAGCCTGCTGACGGCCACTGTGGTCCCGCCCTCGGGCCGGGAGGAGCCCTGTTTGCTGAAGCGGCTGCGTAATGGCCACGTGGGGATTTCATTCGTGCCCAAGGAGACGGGGGAGCACCTGGTGCATGTGAAGAAAAATGGCCAGCACGTGGCCAGCAGCCCCATCCCGGTGGTGATCAGCCAGTCGGAAATTGGGGATGCCAGTCGTGTTCGGGTCTCTGGTCAGGGCCTTCACGAAGGCCACACCTTTGAGCCTGCAGAGTTTATCATTGATACCCGCGATGCAGGCTATGGTGGGCTCAGCCTGTCCATTGAGGGCCCCAGCAAGGTGGACATCAACACAGAGGACCTGGAGGACGGGACGTGCAGGGTCACCTACTGCCCCACAGAGCCAGGCAACTACATCATCAACATCAAGTTTGCCGACCAGCACGTGCCTGGCAGCCCCTTCTCTGTGAAGGTGACAGGCGAGGGCCGGGTGAAAGAGAGCATCACCCGCAGGCGTCGGGCTCCTTCAGTGGCCAACGTTGGTAGTCATTGTGACCTCAGCCTGAAAATCCCTGAAATTAGCATCCAGGATATGACAGCCCAGGTGACCAGCCCATCGGGCAAGACCCATGAGGCCGAGATCGTGGAAGGGGAGAACCACACCTACTGCATCCGCTTTGTTCCCGCTGAGATGGGCACACACACAGTCAGCGTGAAGTACAAGGGCCAGCACGTGCCTGGGAGCCCCTTCCAGTTCACCGTGGGGCCCCTAGGGGAAGGGGGAGCCCACAAGGTCCGAGCTGGGGGCCCTGGCCTGGAGAGAGCTGAAGCTGGAGTGCCAGCCGAATTCAGTATCTGGACCCGGGAAGCTGGTGCTGGAGGCCTGGCCATTGCTGTCGAGGGCCCCAGCAAGGCTGAGATCTCTTTTGAGGACCGCAAGGACGGCTCCTGTGGTGTGGCTTATGTGGTCCAGGAGCCAGGTGACTACGAAGTCTCAGTCAAGTTCAACGAGGAACACATTCCCGACAGCCCCTTCGTGGTGCCTGTGGCTTCTCCGTCTGGCGACGCCCGCCGCCTCACTGTTTCTAGCCTTCAGGAGTCAGGGCTAAAGGTCAACCAGCCAGCCTCTTTTGCAGTCAGCCTGAACGGGGCCAAGGGGGCGATCGATGCCAAGGTGCACAGCCCCTCAGGAGCCCTGGAGGAGTGCTATGTCACAGAAATTGACCAAGATAAGTATGCTGTGCGCTTCATCCCTCGGGAGAATGGCGTTTACCTGATTGACGTCAAGTTCAACGGCACCCACATCCCTGGAAGCCCCTTCAAGATCCGAGTTGGGGAGCCTGGGCATGGAGGGGACCCAGGCTTGGTGTCTGCTTACGGAGCAGGTCTGGAAGGCGGTGTCACAGGGAACCCAGCTGAGTTCGTCGTGAACACGAGCAATGCGGGAGCTGGTGCCCTGTCGGTGACCATTGACGGCCCCTCCAAGGTGAAGATGGATTGCCAGGAGTGCCCTGAGGGCTACCGCGTCACCTATACCCCCATGGCACCTGGCAGCTACCTCATCTCCATCAAGTACGGCGGCCCCTACCACATTGGGGGCAGCCCCTTCAAGGCCAAAGTCACAGGCCCCCGTCTCGTCAGCAACCACAGCCTCCACGAGACATCATCAGTGTTTGTAGACTCTCTGACCAAGGCCACCTGTGCCCCCCAGCATGGGGCCCCGGGTCCTGGGCCTGCTGACGCCAGCAAGGTGGTGGCCAAGGGCCTGGGGCTGAGCAAGGCCTACGTAGGCCAGAAGAGCAGCTTCACAGTAGACTGCAGCAAAGCAGGCAACAACATGCTGCTGGTGGGGGTTCATGGCCCAAGGACCCCCTGCGAGGAGATCCTGGTGAAGCACGTGGGCAGCCGGCTCTACAGCGTGTCCTACCTGCTCAAGGACAAGGGGGAGTACACACTGGTGGTCAAATGGGGGGACGAGCACATCCCAGGCAGCCCCTACCGCGTTGTGGTGCCCTGAGTCTGGGGCCCGTGCCAGCCGGCAGCCCCCAAGCCTGCCCCGCTACCCAAGCAGCCCCGCCCTCTTCCCCTCAACCCCGGCCCAGGCCGCCCTGGCCGCCCGCCTGTCACTGCAGCCGCCCCTGCCCTGTGCCGTGCTGCGCTCACCTGCCTCCCCAGCCAGCCGCTGACCTCTCGGCTTTCACTTGGGCAGAGGGAGCCATTTGGTGGCGCTGCTTGTCTTCTTTGGTTCTGGGAGGGGTGAGGGATGGGGGTCCTGTACACAACCACCCACTAGTTCTCTTCTCCAGCCAAGAGGAATAAAGTTTTGCTTCCATTCT