Transcript asmbl_174206

Sequence
Transcript Sequence for observation asmbl_174206 of TGE0056118:
TTCGCGTGGAGGCGCGTCGCGCGCAGCGGACGCCGACAGAATCCCCGAGGCGCCTGGCGCGGGCGCGGGCGCGAAGGCGATCCGGGCGCCACCCCGCGGTCATCGGTCACCGGTCGCTCTCAGGAACAGCAGCGCAACCTCTGCTCCCTGCCTCGCCTCCCGCGCGCCTAGGTGCCTGCGACTTTAATTAAAGGGCCGTCCCCTCGCCGAGGCTGCAGCACCGCCCCCCCGGCTTCTCGCGCCTCAAAATGAGTAGCTCCCACTCTCGGGCGGGCCAGAGCGCAGCAGGCGCGGCTCCGGGCGGCGGCGTCGACACGCGGGACGCCGAGATGCCGGCCACCGAGAAGGACCTGGCGGAGGACGCGCCGTGGAAGAAGATCCAGCAGAACACTTTCACGCGCTGGTGCAACGAGCACCTGAAGTGCGTGAGCAAGCGCATCGCCAACCTGCAGACGGACCTGAGCGACGGGCTGCGGCTTATCGCGCTGTTGGAGGTGCTCAGCCAGAAGAAGATGCACCGCAAGCACAACCAGCGGCCCACTTTCCGCCAAATGCAGCTTGAGAACGTGTCGGTGGCGCTCGAGTTCCTGGACCGCGAGAGCATCAAACTGGTGTCCATCGACAGCAAGGCCATCGTGGACGGGAACCTGAAGCTGATCCTGGGCCTCATCTGGACCCTGATCCTGCACTACTCCATCTCCATGCCCATGTGGGACGAGGAGGAGGATGAGGAGGCCAAGAAGCAGACCCCCAAGCAGAGGCTCCTGGGCTGGATCCAGAACAAGCTGCCGCAGCTGCCCATCACCAACTTCAGCCGGGACTGGCAGAGCGGCCGGGCCCTGGGCGCCCTGGTGGACAGCTGTGCCCCGGGCCTGTGTCCTGACTGGGACTCTTGGGACGCCAGCAAGCCCGTTACCAATGCGCGAGAGGCCATGCAGCAGGCGGATGACTGGCTGGGCATCCCCCAGGTGATCACCCCCGAGGAGATTGTGGACCCCAACGTGGACGAGCACTCTGTCATGACCTACCTGTCCCAGTTCCCCAAGGCCAAGCTGAAGCCAGGGGCTCCCTTGCGGCCCAAACTGAACCCGAAGAAAGCCCGTGCCTACGGGCCAGGCATCGAGCCCACAGGCAACATGGTGAAGAAGCGGGCAGAGTTCACTGTGGAGACCAGAAGTGCTGGCCAGGGAGAGGTGCTGGTGTACGTGGAGGACCCGGCCGGACACCAGGAGGAGGCAAAAGTGACCGCCAATAACGACAAGAACCGCACCTTCTCCGTCTGGTACGTCCCCGAGGTGACGGGGACTCATAAGGTTACTGTGCTCTTTGCTGGCCAGCACATCGCCAAGAGCCCCTTCGAGGTGTACGTGGATAAGTCACAGGGTGACGCCAGCAAAGTGACAGCCCAAGGTCCCGGCCTGGAGCCCAGTGGCAACATCGCCAACAAGACCACCTACTTTGAGATCTTTACGGCAGGAGCTGGCACGGGCGAGGTCGAGGTTGTGATCCAGGACCCCATGGGACAGAAGGGCACGGTAGAGCCTCAGCTGGAGGCCCGGGGCGACAGCACATACCGCTGCAGCTACCAGCCCACCATGGAGGGCGTCCACACCGTGCACGTCACGTTTGCCGGCGTGCCCATCCCTCGCAGCCCCTACACTGTCACTGTTGGCCAAGCCTGTAACCCGAGTGCCTGCCGGGCGGTTGGCCGGGGCCTCCAGCCCAAGGGTGTGCGGGTGAAGGAGACAGCTGACTTCAAGGTGTACACAAAGGGCGCTGGCAGTGGGGAGCTGAAGGTCACCGTGAAGGGCCCCAAGGGAGAGGAGCGCGTGAAGCAGAAGGACCTGGGGGATGGCGTGTATGGCTTCGAGTATTACCCCATGGTCCCTGGAACCTATATCGTCACCATCACGTGGGGTGGTCAGAACATCGGGCGCAGTCCCTTCGAAGTGAAGGTGGGCACCGAGTGTGGCAATCAGAAGGTACGGGCCTGGGGCCCTGGGCTGGAGGGCGGCGTCGTTGGCAAGTCAGCAGACTTTGTGGTGGAGGCTATCGGGGACGACGTGGGCACGCTGGGCTTCTCGGTGGAAGGGCCATCGCAGGCTAAGATCGAATGTGACGACAAGGGCGACGGCTCCTGTGATGTGCGCTACTGGCCGCAGGAGGCTGGCGAGTATGCCGTTCACGTGCTGTGCAACAGCGAAGACATCCGCCTCAGCCCCTTCATGGCTGACATCCGTGACGCGCCCCAGGACTTCCACCCAGACAGGGTGAAGGCACGTGGGCCTGGATTGGAGAAGACAGGTGTGGCCGTCAACAAGCCAGCAGAGTTCACAGTGGATGCCAAGCACGGTGGCAAGGCCCCACTTCGGGTCCAAGTCCAGGACAATGAAGGCTGCCCTGTGGAGGCGTTGGTCAAGGACAACGGCAATGGCACTTACAGCTGCTCCTACGTGCCCAGGAAGCCGGTGAAGCACACAGCCATGGTGTCCTGGGGAGGCGTCAGCATCCCCAACAGCCCCTTCAGGGTGAATGTGGGAGCTGGCAGCCACCCCAACAAGGTCAAAGTATACGGCCCCGGAGTAGCCAAGACAGGGCTCAAGGCCCACGAGCCCACCTACTTCACTGTGGACTGCGCCGAGGCTGGCCAGGGGGACGTCAGCATCGGCATCAAGTGTGCCCCTGGAGTGGTAGGCCCCGCCGAAGCTGACATCGACTTCGACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGGCTGGCAGCTACACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCCCATCCGAGTCAAGGTGGAGCCCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGCCCTGGCCTCAGTCGCACTGGTGTCGAGCTTGGCAAGCCCACCCACTTCACAGTAAATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTCTCAGGACTCACCAAGGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTACACAGTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAGGGGATCCCATCCCTAAGAGCCCTTTCTCAGTGGCAGTATCTCCAAGCCTGGACCTCAGCAAGATCAAGGTGTCTGGCCTGGGAGAGAAGGTGGACGTTGGCAAAGACCAGGAGTTCACAGTCAAATCAAAGGGTGCTGGTGGTCAAGGCAAAGTGGCATCCAAGATTGTGGGCCCCTCGGGTGCAGCGGTGCCCTGCAAGGTGGAGCCAGGCCTGGGGGCTGACAACAGTGTGGTGCGCTTCCTGCCCCGTGAGGAAGGGCCCTATGAGGTGGAGGTGACCTATGACGGCGTGCCCGTGCCTGGCAGCCCCTTTCCTCTGGAAGCTGTGGCCCCCACCAAGCCTAGCAAGGTGAAGGCGTTTGGGCCGGGGCTGCAGGGAGGCAGTGCGGGCTCCCCCGCCCGCTTCACCATCGACACCAAGGGCGCCGGCACAGGTGGCCTGGGCCTGACGGTGGAGGGCCCCTGTGAGGCGCAGCTCGAGTGCTTGGACAATGGGGATGGCACATGTTCCGTGTCCTACGTGCCCACCGAGCCCGGGGACTACAACATCAACATCCTCTTCGCTGACACCCACATCCCTGGCTCCCCATTCAAGGCCCACGTGGTTCCCTGCTTTGACGCATCCAAAGTCAAGTGCTCAGGCCCCGGGCTGGAGCGGGCCACCGCTGGGGAGGTGGGCCAATTCCAAGTGGACTGCTCGAGCGCGGGCAGCGCGGAGCTGACCATTGAGATCTGCTCGGAGGCGGGGCTTCCGGCCGAGGTGTACATCCAGGACCACGGTGATGGCACGCACACCATTACCTACATTCCCCTCTGCCCCGGGGCCTACACCGTCACCATCAAGTACGGCGGCCAGCCCGTGCCCAACTTCCCCAGCAAGCTGCAGGTGGAACCTGCGGTGGACACTTCCGGTGTCCAGTGCTATGGGCCTGGTATTGAGGGCCAGGGTGTCTTCCGTGAGGCCACCACTGAGTTCAGTGTGGACGCCCGGGCTCTGACACAGACCGGAGGGCCGCACGTCAAGGCCCGTGTGGCCAACCCCTCAGGCAACCTGACGGAGACCTACGTTCAGGACCGTGGCGATGGCATGTACAAAGTGGAGTACACGCCTTACGAGGAGGGACTGCACTCCGTGGACGTGACCTATGACGGCAGTCCCGTGCCCAGCAGCCCCTTCCAGGTGCCCGTGACCGAGGGCTGCGACCCCTCCCGGGTGCGTGTCCACGGGCCAGGCATCCAAAGTGGCACCACCAACAAGCCCAACAAGTTCACTGTGGAGACCAGGGGAGCTGGCACGGGCGGCCTGGGCCTGGCTGTAGAGGGCCCCTCCGAGGCCAAGATGTCCTGCATGGATAACAAGGACGGCAGCTGCTCGGTCGAGTACATCCCTTATGAGGCTGGCACCTACAGCCTCAACGTCACCTATGGTGGCCATCAAGTGCCAGGCAGTCCTTTCAAGGTCCCTGTGCATGATGTGACAGATGCGTCCAAGGTCAAGTGCTCTGGGCCCGGCCTGAGCCCAGGCATGGTTCGTGCCAACCTCCCTCAGTCCTTCCAGGTGGACACAAGCAAGGCTGGTGTGGCCCCATTGCAGGTCAAAGTGCAAGGGCCCAAAGGCCTGGTGGAGCCAGTGGACGTGGTAGACAACGCTGATGGCACCCAGACCGTCAATTATGTGCCCAGCCGAGAAGGGCCCTACAGCATCTCAGTACTGTATGGAGATGAAGAGGTACCCCGGAGCCCCTTCAAGGTCAAGGTGCTGCCTACTCATGATGCCAGCAAGGTGAAGGCCAGTGGCCCCGGGCTCAACACCACTGGCGTGCCTGCCAGCCTGCCCGTGGAGTTCACCATCGATGCAAAGGACGCCGGGGAGGGCCTGCTGGCTGTCCAGATCACGGATCCCGAAGGCAAGCCGAAGAAGACACACATCCAAGACAACCATGACGGCACGTATACAGTGGCCTACGTGCCAGACGTGACAGGTCGCTACACCATCCTCATCAAGTACGGTGGTGACGAGATCCCCTTCTCCCCGTACCGCGTGCGTGCCGTGCCCACCGGGGACGCCAGCAAGTGCACTGTCACAGGTGCTGGCATCGGCCCCACCATTCAGATTGGGGAGGAGACGGTGATCACTGTGGACACTAAGGCGGCAGGCAAAGGCAAAGTGACGTGCACCGTGTGCACGCCTGATGGCTCAGAGGTGGATGTGGACGTGGTGGAGAATGAGGACGGCACTTTCGACATCTTCTACACGGCCCCCCAGCCGGGCAAATACGTCATCTGTGTGCGCTTTGGTGGCGAGCACGTGCCCAACAGCCCCTTCCAAGTGACGGCTCTGGCTGGGGACCAGCCCTCGGTGCAGCCCCCTCTACGGTCTCAGCAGCTGGCCCCACAGTACACCTACGCCCAGGGCGGCCAGCAGACTTGGGCCCCGGAGAGGCCCCTGGTGGGTGTCAATGGGCTGGATGTGACCAGCCTGAGGCCCTTTGACCTTGTCATCCCCTTCACCATCAAGAAGGGCGAGATCACAGGGGAGGTTCGGATGCCCTCAGGCAAGGTGGCGCAGCCCACCATCACTGACAACAAAGACGGCACCGTGACCGTGCGGTATGCACCCAGCGAGGCTGGCCTGCACGAGATGGACATCCGCTATGACAACATGCACATCCCAGGAAGCCCCTTGCAGTTCTATGTGGATTACGTCAACTGTGGCCATGTCACTGCCTATGGGCCTGGCCTCACCCATGGAGTAGTGAACAAGCCTGCCACCTTCACCGTCAACACCAAGGATGCAGGAGAGGGGGGCCTGTCTCTGGCCATTGAGGGCCCGTCCAAAGCAGAAATCAGCTGCACTGACAACCAGGATGGGACATGCAGCGTGTCCTACCTGCCTGTGCTGCCGGGGGACTACAGCATTCTAGTCAAGTACAATGAACAGCACGTCCCAGGCAGCCCCTTCACTGCTCGGGTCACAGGTGACGACTCCATGCGTATGTCCCACCTAAAGGTCGGCTCTGCTGCCGACATCCCCATCAACATCTCAGAGACGGATCTCAGCCTGCTGACGGCCACTGTGGTCCCGCCCTCGGGCCGGGAGGAGCCCTGTTTGCTGAAGCGGCTGCGTAATGGCCACGTGGGGATTTCATTCGTGCCCAAGGAGACGGGGGAGCACCTGGTGCATGTGAAGAAAAATGGCCAGCACGTGGCCAGCAGCCCCATCCCGGTGGTGATCAGCCAGTCGGAAATTGGGGATGCCAGTCGTGTTCGGGTCTCTGGTCAGGGCCTTCACGAAGGCCACACCTTTGAGCCTGCAGAGTTTATCATTGATACCCGCGATGCAGGCTATGGTGGGCTCAGCCTGTCCATTGAGGGCCCCAGCAAGGTGGACATCAACACAGAGGACCTGGAGGACGGGACGTGCAGGGTCACCTACTGCCCCACAGAGCCAGGCAACTACATCATCAACATCAAGTTTGCCGACCAGCACGTGCCTGGCAGCCCCTTCTCTGTGAAGGTGACAGGCGAGGGCCGGGTGAAAGAGAGCATCACCCGCAGGCGTCGGGCTCCTTCAGTGGCCAACGTTGGTAGTCATTGTGACCTCAGCCTGAAAATCCCTGAAATTAGCATCCAGGATATGACAGCCCAGGTGACCAGCCCATCGGGCAAGACCCATGAGGCCGAGATCGTGGAAGGGGAGAACCACACCTACTGCATCCGCTTTGTTCCCGCTGAGATGGGCACACACACAGTCAGCGTGAAGTACAAGGGCCAGCACGTGCCTGGGAGCCCCTTCCAGTTCACCGTGGGGCCCCTAGGGGAAGGGGGAGCCCACAAGGTCCGAGCTGGGGGCCCTGGCCTGGAGAGAGCTGAAGCTGGAGTGCCAGCCGAATTCAGTATCTGGACCCGGGAAGCTGGTGCTGGAGGCCTGGCCATTGCTGTCGAGGGCCCCAGCAAGGCTGAGATCTCTTTTGAGGACCGCAAGGACGGCTCCTGTGGTGTGGCTTATGTGGTCCAGGAGCCAGGTGACTACGAAGTCTCAGTCAAGTTCAACGAGGAACACATTCCCGACAGCCCCTTCGTGGTGCCTGTGGCTTCTCCGTCTGGCGACGCCCGCCGCCTCACTGTTTCTAGCCTTCAGGAGTCAGGGCTAAAGGTCAACCAGCCAGCCTCTTTTGCAGTCAGCCTGAACGGGGCCAAGGGGGCGATCGATGCCAAGGTGCACAGCCCCTCAGGAGCCCTGGAGGAGTGCTATGTCACAGAAATTGACCAAGATAAGTATGCTGTGCGCTTCATCCCTCGGGAGAATGGCGTTTACCTGATTGACGTCAAGTTCAACGGCACCCACATCCCTGGAAGCCCCTTCAAGATCCGAGTTGGGGAGCCTGGGCATGGAGGGGACCCAGGCTTGGTGTCTGCTTACGGAGCAGGTCTGGAAGGCGGTGTCACAGGGAACCCAGCTGAGTTCGTCGTGAACACGAGCAATGCGGGAGCTGGTGCCCTGTCGGTGACCATTGACGGCCCCTCCAAGGTGAAGATGGATTGCCAGGAGTGCCCTGAGGGCTACCGCGTCACCTATACCCCCATGGCACCTGGCAGCTACCTCATCTCCATCAAGTACGGCGGCCCCTACCACATTGGGGGCAGCCCCTTCAAGGCCAAAGTCACAGGCCCCCGTCTCGTCAGCAACCACAGCCTCCACGAGACATCATCAGTGTTTGTAGACTCTCTGACCAAGGCCACCTGTGCCCCCCAGCATGGGGCCCCGGGTCCTGGGCCTGCTGACGCCAGCAAGGTGGTGGCCAAGGGCCTGGGGCTGAGCAAGGCCTACGTAGGCCAGAAGAGCAGCTTCACAGTAGACTGCAGCAAAGCAGGCAACAACATGCTGCTGGTGGGGGTTCATGGCCCAAGGACCCCCTGCGAGGAGATCCTGGTGAAGCACGTGGGCAGCCGGCTCTACAGCGTGTCCTACCTGCTCAAGGACAAGGGGGAGTACACACTGGTGGTCAAATGGGGGGACGAGCACATCCCAGGCAGCCCCTACCGCGTTGTGGTGCCCTGAGTCTGGGGCCCGTGCCAGCCGGCAGCCCCCAAGCCTGCCCCGCTACCCAAGCAGCCCCGCCCTCTTCCCCTCAACCCCGGCCCAGGCCGCCCTGGCCGCCCGCCTGTCACTGCAGCCGCCCCTGCCCTGTGCCGTGCTGCGCTCACCTGCCTCCCCAGCCAGCCGCTGACCTCTCGGCTTTCACTTGGGCAGAGGGAGCCATTTGGTGGCGCTGCTTGTCTTCTTTGGTTCTGGGAGGGGTGAGGGATGGGGGTCCTGTACACAACCACCCACTAGTTCTCTTCTCCAGCCAAGAGGAATAAAGTTTTGCTTCCATTCT