Transcript asmbl_172747

Sequence
Transcript Sequence for observation asmbl_172747 of TGE0058594:
CTCCTCCTCGAACTCGCCCTCCTCCTCGGCTGTGGCATCCTGGTACTGCTGGTACTCGGACACCAGGTCATTCATGTTGCTCTCGGCCTCGGTGAACTCCATCTCGTCCATGCCCTCGCCCGTGTACCAGTGCAGGAAGGCCTTGCGCCGGAACATGGCCGTGAACTGCTCGGAGATGCGCTTGAACAGCTCCTGGATGGCCGTGCTGTTGCCAATGAAGGTGGCGGACATTTTTAGCCCCCGAGGTGGGATGTCACAGACAGCCGTTTTCACATTGTTGGGGATCCACTCAACAAAATAGCTGCTGTTTTTGTTTTGGACATTAAGCATTTGCTCATCCACCTCCTTCATGGACATGCGGCCCCTGAACACGGCGGCAACCGTCAGGTAGCGGCCATGGCGGGGGTCGCAGGCAGCCATCATGTTCTTGGCATCAAACATCTGCTGGGTGAGCTCGGGCACGGTCAGCGCCCGGTACTGCTGGCTGCCCCGGCTGGTCAGTGGGGCAAAGCCGGGCATGAAGAAGTGCAGCCGGGGAAACGGGACCATGTTCACAGCCAGCTTCCGCAGGTCAGCATTGAGCTGGCCTGGGAAGCGCAGGCAGGTGGTGACCCCACTCATGGTAGCAGACACCAGGTGGTTCAGGTCACCATAGGTGGGCGTGGTCAGCTTTAGGGTTCTGAAGCAAATGTCGTAGAGAGCTTCGTTATCAATGCAGTAGGTCTCGTCTGTGTTTTCTACGAGCTGGTGGACTGAGAGGGTGGCGTTGTAGGGCTCCACCACTGTGTCTGACACTTTGGGCGAAGGCACCACACTAAACGTGTTCATGATCCTGTCTGGGTACTCCTCCCGGATCTTGCTGATGAGGAGGGTACCCATCCCAGACCCAGTCCCCCCACCCAGGGAGTGGGTCAGCTGGAAACCCTGCAGGCAGTCACAGCTCTCAGCCTCCTTTCTCACAACATCCAGCACCGAGTCCACCAGCTCCGCGCCTTCTGTGTAGTGCCCCTTGGCCCAGTTGTTCCCAGCACCACTCTGACCTGTGAGAGAACACAGCTAATCATTTGTCAGCCAGGTAGACAGCACTACTGGTCACCGCCATGCGAAAAAAGCCGAGTGACATGGTGTGAGCTGACCACAGAATTCACCCTGGAGGTAGAGCAAACGGACCCTTCAAAGCCAAAAGACGGCAGCCTGCCCTGCTACGAATTAAGTCAGGGGCCAAACCTGACAGCTTAACAAACCCCTCCCCGGGGGGGCCACTGCCAATTCCCAAGGACAGAGGAACAGCCACTGCCCCAGCTCAGCTCCCTGCAGGGAGATTACGTGTGTGGCGGCTCCTCGCCTCGGCAGACAGCTGGACCTTGCTCCCAAAGCCGATTTAGTAGAGGGGATTGAGTGGCTCAGAGAAGAGGAGGGCGTCCAGGGGCCCCGGCTGCGCAGTTCCCACGGCGGTGCCCTTGGAGCAGCCCCTTGACCTTTGAGCCGCCGCCCAGTCCCCAGCCACGGCTCACCGAAAACGAAGTTGTCCGGCCGGAAGATCTGCCCGAAGGGCCCCGAGCGCACGGAGTCCATGGTGCCGGGCTCCAGATCCACGAGCACGGCGCGGGGCACGTACTTGCCGCCTGCGGGGACGGGAGGGCGTCAGCCAAGGCAGGGGCCGCGGGGTCCCCGGAGGGCGGTCGGGGAAGGGGCCGGGGCCTCACCGGTGGCCTCATTGTAGTACACGTTGATGCGTTCCAGCTGCAGGTCGCTGTCCCCGTGGTAGGTGCCCGTGGGGTCGATGCCGTGCTCATCGCTGATCAC