Transcript asmbl_17068

Sequence
Transcript Sequence for observation asmbl_17068 of TGE0057763:
GCCTTAGGCAGGCCTAGAGACTTTCCCGGGTCCTCCAGGCCGGGGAACGCCCCGCTCGGAGGCCGGGCTTGGGCGGAGACTGCGCCGGGGCTGCTGAAAACTAGCCGAGGAGAGCCAGGGAGCCGGAGAGATCGCGCGCCTGCCGCCGCCGGAGCCTGCGAGCCGAGACCGAGCCATGTGGCTAGAAATCCTCCTCACTTCAGTGCTGGGCTTTGCCATCTACTGGTTCATCTCCCGGGACAAAGAGGAAACTTTGCCACTTGAAGATGGGTGGTGGGGGCCAGGCACGAGGTCCGCAGCCAGGGAGGACGACAGCATCCGCCCTTTCAAGGTGGAAACGTCAGATGAGGAGATCCACGACTTACACCAGAGGATCGATAAGTTCCGTTTCACCCCACCTTTGGAGGACAGCTGCTTCCACTATGGCTTCAACTCCAACTACCTGAAGAAAGTCATCTCCTACTGGCGGAATGAATTTGACTGGAAGAAGCAGGTGGAGATTCTCAACAGATACCCTCACTTCAAGACTAAGATTGAAGGGCTGGACATCCACTTCATCCACGTGAAGCCCCCCCAGCTGCCCGCAGGCCATACCCCGAAGCCCTTGCTGATGGTGCACGGCTGGCCCGGCTCTTTCTACGAGTTTTATAAGATCATCCCACTCCTGACTGACCCCAAGAACCATGGCCTGAGCGATGAGCACGTTTTTGAAGTCATCTGCCCTTCCATCCCTGGCTATGGCTTCTCAGAGGCATCCTCCAAGAAGGGGTTCAACTCGGTGGCCACCGCCAGGATCTTTTACAAGCTGATGCTGCGGCTGGGCTTCCAGGAATTCTACATTCAAGGAGGGGACTGGGGGTCCCTGATCTGCACTAATATGGCCCAGCTGGTGCCCAGCCACGTGAAAGGCCTGCACTTGAACATGGCTTTGGTTTTAAGCAACTTCTCTACCCTGACCCTCCTCCTGGGACAGCGTTTCGGGAGGTTTCTTGGCCTCACTGAGAGGGATGTGGAGCTGCTGTACCCCGTCAAGGAGAAGGTATTCTACAGCCTGATGAGGGAGAGCGGCTACATGCACATCCAGTGCACCAAGCCTGACACCGTAGGCTCTGCTCTGAATGACTCTCCTGTGGGTCTGGCTGCCTATATTCTAGAGAAGTTTTCCACCTGGACCAATACGGAATTCCGATACCTGGAGGATGGAGGCCTGGAAAGGAAGTTCTCCCTGGACGACCTGCTGACCAACGTCATGCTCTACTGGACAACAGGCACCATCATCTCCTCCCAGCGCTTCTACAAGGAGAACCTGGGACAGGGCTGGATGACCCAGAAGCATGAGCGGATGAAGGTCTATGTGCCCACTGGCTTCTCTGCCTTCCCTTTTGAGCTATTGCACACGCCTGAAAAGTGGGTGAGGTTCAAGTACCCAAAGCTCATCTCCTATTCCTACATGGTTCGTGGGGGCCACTTTGCGGCCTTTGAGGAGCCGGAGCTGCTCGCCCAGGACATCCGCAAGTTCCTGTCGGTGCTGGAGCGGCAATGACCCACCCCTCTCCCCCCGCCTGCCACCTCCCCCCACAAGTGCCCTCCAGGCTTTTCTTGGGGAAGATACCCCTTTTCTGAGGAATGAGTTTGCCTCCGTCCCCTGCCCATGCTGGGAGCCCACGCTCACCCCCTCACCCCTCCAAGCTCACTCCCCAACCCCCAACTCCGTGTGGTAAGCAACATGGCTTTGATGATAAACGACTTTACTCTAAAAG