Transcript asmbl_17067

Sequence
Transcript Sequence for observation asmbl_17067 of TGE0057763:
GCCTTAGGCAGGCCTAGAGACTTTCCCGGGTCCTCCAGGCCGGGGAACGCCCCGCTCGGAGGCCGGGCTTGGGCGGAGACTGCGCCGGGGCTGCTGAAAACTAGCCGAGGAGAGCCAGGGAGCCGGAGAGATCGCGCGCCTGCCGCCGCCGGAGCCTGCGAGCCGAGACCGTAAGCGCCCGGGGCCGGCCGGGCCCGCACTCCCCGGACGCAGACGCGGTTCGGGCTCCGCGCGGGCTCGGCCGCCGGGGTGGGCGGCGGGCCGGGGCGCCGAGGGGTCGGGGCTGCGGTCGGCCCGCAGGGGTGCAGAGGGACTTGTAGTTGGTCCGCCCCCAGCTCCTGCCCCGGCCAGGAGACTGCGCGTGCCGCCTACTGGGGGAAGGAGCCTGCAGGCGACCGCGGACTTCTCGCAGGGAATTCCGCGTCCCAGACTGTGGGCGGACGCCGCAGGGAGGGAGGCTCGCGACCCCGAGAGCGCACCGCGTCCCCTGGCCTGGGCGAGCTCTGCTTCCAGGGCCGTGGCTCGCTCGGCGGTGAAATGCACTTAATTTGTCACCCAAGTCGGAACACTGATTTTCATGCGCGTCCGTGTGAAGAGACCACCAAACAGGCTTTGTGAGCCATGTGGCTAGAAATCCTCCTCACTTCAGTGCTGGGCTTTGCCATCTACTGGTTCATCTCCCGGGACAAAGAGGAAACTTTGCCACTTGAAGATGGGTGGTGGGGGCCAGGCACGAGGTCCGCAGCCAGGGAGGACGACAGCATCCGCCCTTTCAAGGTGGAAACGTCAGATGAGGAGATCCACGACTTACACCAGAGGATCGATAAGTTCCGTTTCACCCCACCTTTGGAGGACAGCTGCTTCCACTATGGCTTCAACTCCAACTACCTGAAGAAAGTCATCTCCTACTGGCGGAATGAATTTGACTGGAAGAAGCAGGTGGAGATTCTCAACAGATACCCTCACTTCAAGACTAAGATTGAAGGGCTGGACATCCACTTCATCCACGTGAAGCCCCCCCAGCTGCCCGCAGGCCATACCCCGAAGCCCTTGCTGATGGTGCACGGCTGGCCCGGCTCTTTCTACGAGTTTTATAAGATCATCCCACTCCTGACTGACCCCAAGAACCATGGCCTGAGCGATGAGCACGTTTTTGAAGTCATCTGCCCTTCCATCCCTGGCTATGGCTTCTCAGAGGCATCCTCCAAGAAGGGGTTCAACTCGGTGGCCACCGCCAGGATCTTTTACAAGCTGATGCTGCGGCTGGGCTTCCAGGAATTCTACATTCAAGGAGGGGACTGGGGGTCCCTGATCTGCACTAATATGGCCCAGCTGGTGCCCAGCCACGTGAAAGGCCTGCACTTGAACATGGCTTTGGTTTTAAGCAACTTCTCTACCCTGACCCTCCTCCTGGGACAGCGTTTCGGGAGGTTTCTTGGCCTCACTGAGAGGGATGTGGAGCTGCTGTACCCCGTCAAGGAGAAGGTATTCTACAGCCTGATGAGGGAGAGCGGCTACATGCACATCCAGTGCACCAAGCCTGACACCGTAGGCTCTGCTCTGAATGACTCTCCTGTGGGTCTGGCTGCCTATATTCTAGAGAAGTTTTCCACCTGGACCAATACGGAATTCCGATACCTGGAGGATGGAGGCCTGGAAAGGAAGTTCTCCCTGGACGACCTGCTGACCAACGTCATGCTCTACTGGACAACAGGCACCATCATCTCCTCCCAGCGCTTCTACAAGGAGAACCTGGGACAGGGCTGGATGACCCAGAAGCATGAGCGGATGAAGGTCTATGTGCCCACTGGCTTCTCTGCCTTCCCTTTTGAGCTATTGCACACGCCTGAAAAGTGGGTGAGGTTCAAGTACCCAAAGCTCATCTCCTATTCCTACATGGTTCGTGGGGGCCACTTTGCGGCCTTTGAGGAGCCGGAGCTGCTCGCCCAGGACATCCGCAAGTTCCTGTCGGTGCTGGAGCGGCAATGACCCACCCCTCTCCCCCCGCCTGCCACCTCCCCCCACAAGTGCCCTCCAGGCTTTTCTTGGGGAAGATACCCCTTTTCTGAGGAATGAGTTTGCCTCCGTCCCCTGCCCATGCTGGGAGCCCACGCTCACCCCCTCACCCCTCCAAGCTCACTCCCCAACCCCCAACTCCGTGTGGTAAGCAACATGGCTTTGATGATAAACGACTTTACTCTAAAAG