Transcript asmbl_16840

Sequence
Transcript Sequence for observation asmbl_16840 of TGE0058592:
GTGGAAGAAAAGTCAGGCAAACACAAGCACGCACACACCACTGGGAGATCAGATCTTCTAGCTGGCTCTCTGCTGCCACAGCTCCGCCGAAGGGAGGGGGTGGAAGAGGAGGACTAAACTCAGAGCTGAGAGGAGAGGCAGGTGTGTGCAGGTGCATCACCTGGATCATGAGGTCACCCCTCTGCTGGCTCCTCCCACTTCTCATCTTGGCCTCAGTGGCCCAAGGCCAGCCAACAAGACGACCAAGACCCGGGACTGGGCCCGGGCGCAGACCCAGGCCCAGGCCCAGGCCCACACCCAGCTTTCCTCAGCCTGATGAACCAGCAGAGCCAACAGACCTGCCTCCTCCCCTCCCTCCAGGCCCTCCATCTATCTTCCCTGACTGTCCCCGCGAATGCTACTGCCCCCCTGATTTCCCATCTGCCCTCTACTGTGATAGCCGCAACCTGCGAAAGGTCCCTGTCATCCCGCCCCGCATCCATTACCTCTATCTCCAGAACAACTTCATCACTGAGCTCCCGGTGGAGTCCTTCCAGAATGCCACAGGCCTGCGATGGATTAACCTGGACAACAACCGAATCCGCAAGATAGACCAGAGGGTGCTGGAGAAACTGCCCGGCCTGGTGTTCCTCTACATGGAGAAGAACCAGTTGGAAGAGGTCCCCTCGGCCCTGCCCCGGAACCTGGAGCAGCTGAGGCTGAGCCAGAACCACATCTCCAGAATCCCGCCTGGTGTCTTCAGCAAGCTGGAGAACCTGCTGCTCCTGGATCTCCAGCACAACAGGCTGAGCGACGGCGTCTTCAAGCCCGACACCTTCCATGGCCTCAAGAACCTCATGCAGCTCAACCTGGCCCACAACATCCTGAGAAAGATGCCGCCCAGGGTCCCCACCGCCATTCACCAGCTCTACCTGGACAGTAACAAGATTGAGACCATCCCTAACGGATACTTCAAGAGCTTTCCCAATCTTGCCTTCATTCGGCTTAACTACAACAAGCTGACAGACAGGGGACTCCCCAAGAACTCCTTTAATATCTCCAACCTGCTTGTGCTCCACCTGTCCCACAACAGGATCAGCAGTGTGCCCGCCATCAACAACAGGCTGGAACACCTGTACCTCAACAACAATAGCATCGAGAAAATCAACGGAACCCAGATTTGCCCCAACGACCTAGTGGCGTTCCATGACTTCTCCTCGGACCTGGAGAACGTGCCACACCTGCGCTACCTGCGGCTGGATGGAAACTACTTGAAGCCGCCCATCCCGCTGGACCTCATGATGTGCTTCCGCCTCCTGCAGTCCGTGGTCATCTAGGCCCTACTCCGCCACCGGATCTGCTCTGACCGCACTTGAAGGCTGGGGCCCAGGCACCTGTGCCGGCCATTCGTTTTCTCTCTCTCCCTTTCTTTCTCCCAGCTTTGCCTCCCTTATCCCACCCTCGAGGCAGGGAAAAGCCATCTATTCTTCTGCAGCCTCAGGAGCGAGACTTCAAGGACTCAGTTTGGTTCCACCCAGTTGAAAGACACCCAGTGCACACCCAAACTCCTGGCCTTCTGTGGTTTCCCTTTGCTCCAGAAACACAGATGTGTCTAAAGACTTGGTGTCCCCTTCTCTCTCCTCCCCCACCCGCCACTCCTGGGTACATCTGGGCCGTGGACTATCTGATCTTGGTCCTGGCCGAGCAAACAGCCCGGAGGTAAGGTTCAGAAAGTCCCCCTGGGGACTCCTCCATCTTCGGCAGCTCTGGCTCAAAGAGGCCGAGAAACCCAGTTCTCCTGGGCCAAGGATCCCTTCTGGCAAAGCTGCTGCTCCGCCGCTTGGTTCCCCGGCACCAGACATCGCCCTGGCCCTGCTGGCCCGGGTATCGGGAAGGAGGAGCGAGGGAATGACGGAGGTAGGGTGCAGGGTCAGGGCTCCCGCAGGGGCCTGCATCTGGCCAGCAGGACACAGGGATGCGCAGGGCGCCCCCTTCTGTTCCAGGGTGAACATAGCACACGCCCTCCTGGCTGGGCCTCAGGAGGAACAGCCAAGGAGAAGAATGGCCCAAGGAACTAGGAAGCAGCCATGGGAGAGGGGAAGGGTTCAAGCCCGGGATGGGCCCGCGTGACGTCGATGGGTCCTGCGGCCCCCTTGCCCAACCTCGGGTTTAGGGAGGAGGGTTCACAGTGTTTTTGTGGGGGCGGGGGAAGGAAGAGGCAGCCCCGCCCCCGCCATCTGTTCTCCATCAGTGTGCGCGGCCCAGCCATTTCCACCCTCGGGAGGCGGCTCCTGAGAAACAGGGAGGAAGGGGCGGAGCACCTGGACGTCTCCCAGAAGCCCCTCCACGTTTGAAAATGCGCCTCCTCCTCGGAGACAGACGCATCGGTGCCACCTAGTGGCTGGTGGGAGTAACAGCTGGTCCCAGTCTTGCGCCTGGCCCTCTTCCTGGGGTGATTTTCCTCGGTGGAGGAGGCCCGTGGGGTCCCAACACGGAAGAGCCATGGGCCGTGTGCATGGTGTCGCTCTCCTCTAGGGTCTAGCGGGCACAAACGTCCCCAGGCTGGGCTCATTCCCATCGTGAGTGAGCCCAGGTGAGGACATAGTCGGCTCCCGTTTGTTGTAGGCCCTTCCCAGGTGCCTTCTCAGCTCCCTCATCTGTAAACCGAGGAGGTGGATAAGATGCTCCCGGCCGGGC