Transcript asmbl_167231

Sequence
Transcript Sequence for observation asmbl_167231 of TGE0056108:
GTTCTTAAAGCTGCTGGGCCCTGAAATTTTACTCAGCAGTTTGAAATCAAGACATAGCTTTTCTCATTCACCCTCCCACTTGGGGCTAATGCACAGACATGAACATCTATTGAGGAAAACCACAAAAAACTTCAAAACAGCTACAACGGGAAAAAGAGAGTTTTGTCCCACAGTCAGCAGGCCACTAGTTTATTAACTTCCAGTCACCTTGATTTTTGCTAAAATGAAGACTCTGCAGTCTACACTTCTCCTGTTACTGCTTGTGCCTCTGATAAAGCCAGCACCACCAACCCAGCAGGACTCACGCATTATCTATGATTATGGAACAGATAATTTTGAAGAATCCATATTTAGCCAAGATTATGAGGATAAATACCTGGATGGAAAAAATATTAAGGAAAAAGAAACTGTGATAATACCCAATGAGAAAAGTCTTCAATTACAAAAAGATGAGGCAATAACACCATTACCTCCCAAGAAAGAAAATGATGAAATGCCCACGTGTCTGCTGTGTGTTTGTTTAAGTGGCTCTGTATACTGTGAAGAAGTTGACATTGATGCTGTACCACCCTTACCAAAGGAATCAGCCTATCTTTACGCACGATTCAACAAAATTAAAAAGCTGACTGCCAAAGATTTTGCAGACATACCTAACTTAAGAAGACTCGATTTTACAGGAAATTTGATAGAAGATATAGAAGATGGTACTTTTTCAAAACTTTCTCTGTTAGAAGAACTTTCACTTGCTGAAAATCAACTACTAAAACTTCCAGTTCTTCCTCCCAAGCTCACTTTATTTAATGCAAAATACAACAAAATCAAGAGTAGGGGAATCAAAGCAAATGCATTCAAAAAACTGAATAACCTCACCTTCCTCTACTTGGACCATAATGCCCTGGAATCCGTGCCTCTTAATTTACCAGAAAGTCTACGTGTAATTCATCTTCAGTTCAACAACATAGCTTCAATTACAGATGACACATTCTGCAAGGCTAATGACACCAGTTACATCCGGGACCGCATTGAAGAGATACGCCTGGAGGGCAATCCAATCGTCCTGGGAAAGCATCCAAACAGTTTTATTTGCTTAAAAAGATTACCGATAGGGTCATACTTTTAACCTCTATTGGTACAACATATAAATGAAAGTACACCTACACTAATAGTCTGTCTCAACAATGAGTAAAGGAACTTAAGTATTGGTTTAATATTAACCTTGTATCTCATTTTGAAGGAATTTAATATTTTAAGCAAGGATGTTCAAAATCTTACATATAATAAGTAAAAAGTAAGACTGAATGTCTACGTTCGAAACAAAGTAATATGAAAATATTTAAACAGCATTACAAAATCCTAGTTTATACTAGACTACCATTTAAAAATCATGTTTTTATATAAATGCCCAAATTTGAGATGCATTATTCCTATTACTAATGATGTAAGTACGAGGATAAATCCAAGAAACTTTCAACTCTTTGCCTTTCCTGGCCTTTACTGGATCCCAAAAGCATTTAAGGTACATGTTCCAAAAACTTTGAAAAGCTAAATGTTTCCCATGATCGCTCATTCTTCTTTTATGATTCATACGTTATTCCTTATAAAGTAAGAACTTTGTTTTCCTCCTATCAAGGCAGCTATTTTATTAAATTTTTCACTTAGTCTGAGAAATAGCAGATAGTCTCATATTTAGGAAAACTTTCCAAATAAAATAAATGTTATTCTCTGATAAAGAGCTAATACAGAAATGTTCAAGTTATTTTACTTTCTGGTAATGTCTTCAGTAAAATATTTTCTTTATCTAAATATTAACATTCTAAGTCTACCAAAAAAAGTTTTAAACTCAAGCAGGCCAAAACCAATATGCTTATAAGAAATAATGAAAAGTTCATCCATTTCTGATAAAGTTCTCTATGGCAAAGTCTTTCAAATACGAGATAACTGCAAAATATTTTCCTTTTATACTACAGAAATGAGAATCTCATCAATAAATTAGTTCAAGCATAAGATGAAAACAGAATATTCTGTGGTGCCAGTGCACACTACCTTCCCACCCATACACATCCATGTTCACTGTAACAAACTGAATATTCACAATAAAGCTTCTGAGTAACACTTTCTGATTACTCATGATAAACTGACATGGCTAACTGCAAGAATTAAATCTTCTATCTGAGAGTAATAATTTATGATGACTCAGTGGTGCCAGAGTAAAGTTTCTAAAATAACATTCCTCTCACTTGTACCCCACTAAAAGTATTAGACTACACATTACATTGAAGTTAAACACAAAATTATCAGTGTTTTAGAAACATGAGTCCGGACTGTGTAAGTAAAAGTACAAACATTATTTCCACCATAAAGTATGTATTGAAATCAAGTTGTCTCTGTGTACAGAATACATACTTATTCCCATTTTTAAGCATTTGCTTCTGTTTTCCCTACCTAGAATGTCAGATGTTTTTCAGTTATCTCCCCATTTGTCAAAGTTGACCTCAAGATAACATTTTTCATTAAAGCATCTGAGATCTAAGAACACAATTATTATTCTAACAATGATTATTAGCTCATTCACTTATTTTGATAACTAATGATCACAGCTATTATACTACTTTCTCGTTATTTTGTGTGCATGCCTCATTTCCCTGACTTAAACCTCACTGAGAGCGCAAAATGCAGCTTTATACTTTTTACTTTCAATTGCCTAGCACAATAGTGAGTACATTTGAATTGAATATATAATAAATATTGCAAAATAAAATCCATCTAAATAGAAGGGTTCTGTTTTATTTGGAAAAATTGAATCTTTAAACTATCATAATCTTGAATGACTGTCATCTTTCTAGTTTTCAGAAAAATAATG