Transcript asmbl_16710

Sequence
Transcript Sequence for observation asmbl_16710 of TGE0058586:
GTAATGGGATGCTCAGCGCTCTGCATTTTAAAGCACATTGTTGAAGTAAGAATTCTATTTCCAGAAACGGAACATTTCTATAACACTAACTGGGAGACCTATTCTGTAGAGATGTGTAATTTCTAAAATTTCAGCCCATGCTCTCTTCCATTTTTTACCCTGACTTCCATTGTTCATAAAACAAAATCCAGTTGGAACTCCCTGAAAGGCCCCCTTTTTACTTGTTGGGAGTTTAGCTCAAATGTGTCCTTGAACTTGTTTCAGATTTTGATAGGCGTGTGAACGATAACAAGACGGCCGCAGAGGAGGCACTAAGGAAGATTCCTGCCATCAACCAGACCATCACTGAAGCCAATGAAAAGACCAGAGAAGCCCAGCAGGCCCTGGGCAGTGCTGCGGCGGATGCCACAGAGGCCAAGAACAAGGCCCATGAGGCGGAGAGGATCGCGAGCGCTGTCCAAAAGAATGCCACCAGCACCAAGGCAGAAGCTGAAAGAACTTTTGCAGAAGTTACAGATCTGGATAATGAGGTGAACAATATGTTGAAGCAACTGCAGGAAGCAGAAAAAGAGCTAAAGAGAAAACAAGATGACGCTGACCAGGACATGATGATGGCAGGGATGGCTTCACAGGCTGCTCAAGAAGCCGAGATCAATGCCAGAAAAGCCAAAAACTCTGTTACTAGCCTCCTCAGCATTATTAATGACCTCTTGGAGCAGCTGGGGCAGCTGGATACAGTGGACCTGAATAAGCTAAACGAGATTGAAGGCACCCTAAACAAAGCCAAAGATGAAATGAAGGTCAGCGATCTTGATAGGAAAGTGTCTGACCTGGAGAATGAAGCCAAGAAGCAGGAGGCTGCCATCATGGACTATAACCGAGATATCGAGGAGATCATGAAGGACATTCGCAATCTGGAGGACATCAGGAAGACCTTACCATCTGGCTGCTTCAACACCCCGTCCATTGAAAAGCCCTAGTGTCTTTAGGGCTGGAAGGCAGCATCCCTCTGACAGGGGGGCAGTTGTGAGGCCACAGAGTGCCTTGACACAAAGATTACATTTTTCAGACCCCCACTCCTCTGCTGCTGTCCATGACTGTCCTTTTGAACCAGGAAAAGTCACAGAGTTTAAAGAGAAGCAAATTAAACATCCTGAATCGGGAACAAAGGGTTTTATCTAATAAAGTGTCTCTTCCATTCACGTTGCTACCTTACCCACACTTTCCCTTCTGATTTGCGTGAGGACGTGGCATCCTACGTTACTGTACAGTGGCATAAGCACATCGTGTGAGCCCATGTATGCTGGGGTAGAGCAAGTAGCCCTCCCCTGTCTCATCGATACCAGCAGAACCTCCTCAGTCTCAGTACTCTTGTTTCTATGAAGGAAAAGTTTGGCTACTAACAGTAGCATTGTGATGGCCAGTATATCCAGTCCATGGATAAAGAAAATGCATCTGCATCTCCTACCCCTCTTCCTTCTAAGCAAAAGGAAATAAACATCCTGTGCCAAAGGTATTGGTCATTTAGAATGTCGGTAGCCATCCATCAGTGCTTTTAGTTATTATGAGTGTAGGACACTGAGCCATCCGTGGGTCAGGATGCAATTATTTATAAAAGTCTCCAGGTGAACATGGCTGAAGATTTTTCTAGTATATTAATAATTGACTAGGAAGATGAACTTTTTTTCAGATCTTTGGGCAGCTGATAATTTAAATCTGGATGGGCAGCTTGCACTCACCAATAGACCAAAAGACATCTTTTGATATTCTTATAAATGGAACTTACACAGAAGAAATAGGGATATGATAACCACTAAAATTTTGTTTTCAAAATCAAACTAATTCTTACAGCTTTTTTATTAGTTAGTCTTGGAACTAGTGTTAAGTATCTGGCAGAGAACAGTTAATCCCTAAGGTCTTGACAAAACAGAAGAAAAACAAGCCTCCTCGTCCTAGTCTTTTCTAGCAAAGGGATAAAACTTAGATGGCAGCTTGTACTGTCAGAATCCCGTGTATCCATTTGTTCTTCTGTTGGAGAGATGAGACATTTGACCCTTAGCTCCAGTTTTCTTCTGATGTTTCCATCTTCCAGAATCCCTCAAAAAACATTGTTTGCCAAATCCTGGTGGCAAATACTTGCACTCAGTATTTCACACAGCTGCCAACGCTATCGAGTTCCTGCACTTTGTGATTTAAATCCACTCTAAACCTTCCCTCTAAGTGTAGAGGGAAGACCCTTACGTGGAGTTTCCTAGTGGGCTTCTCAACTTTTGATCCTCAGCTCTGTGGTTTTAAGACCACAGTGTGACAGTTCCCTGCCACACACCCCCTTCCTCCTACCAACCCACCTTTGAGATTCATATATAGCCTTTAACACTATGCAACTTTGTACTTTGCGTAGCAGGGGCGGGGTGGGGGGAAAGAAACTATTATCTGACACACTGGTGCTATTAATTATTTCAAATTTATATTTTTGTGTGAATGTTTTGTGTTTTGTTTATCATGATTATAGAATAAGGAATTTATGTAAATATACTTAGTCCTATTTCTAGAATGACACTCTGTTCACTTTGCTCAATTTTTCCTCTTCACTGGCACAATGTATCTGAATACCTCCTTCCCTCCCTTCTAGAATTCTTTGGATTGTACTCCAAAGAATTGTGCCTTGTGTTTGCAGCATCTCCATTCTCTAAAATTAATATAATTGCTTTCCTCCACACCCAGCCACTGTAAAGAGGTAACTTGGGTCCTCTTCCATTGCAGTCCTGATGATCCTAACCTGCAGCACGGTGGTTTTACAATGTTCCAGAGCAGGAACGCCAGGTTGACAAGCTATGGTAGGATTAGGAAAGTTTGCTGAAGAGGATCTTTGACGCCACAGTGGGACTAGCCAGGAATGAGGGAGAAATGCCCTTTCTGGCAATTGTTGGAGCTGGATAGGTAAGTTTTATAAGGGAGTACATTTTGACTGAGCACTTAGGGCATCAGGAACAGTGCTACTTACTGATGGGTAGACTGGGAGAGGTGGTGTAACTTAGTTCTTGATGATCCCACTTCCTGTTTCCATCTGCTTGGGATATACCAGAGTTTACCACAAGTGTTTTGACGATATACTCCTGAGCTTTCACTCTGCTGCTTCTCCCAGGCCTCTTCTACTATGGCAGGAGATGTGGCGTGCTGTTGCAAAGTTTTCACGTCATTGTTTCCTGGCTAGTTCATTTCATTAAGTGGCTACATCCTAACATATGCATTTGGTCAAGGTTGCAGAAGAGGACTGAAGATTGACTGCCAAGCTAGTTTGGGTGAAGTTCACTCCAGCAAGTCTCAGGCCACAATGGGGTGGTTTGGTTTGGTTTCCTTTTAACTTTCTTTTTGTTATTTGCTTTTCTCCTCCACCTGTGTGGTATATTTTTTAAGCAGAATTTTATTTTTTAAAATAAAAGGTTCTTTACAAGATGATACCTTAATTACACTCCCGCAACACAGCCATTATTTTATTGTCTAGCTCCAGTTATCTGTATTTTATGTAATGTAATTGACAGGATGGCTGCTGCAGAATGCTGGTTGACACAGGGATTATTATACTGCTATTTTTCCCTGAATTTTTTTCCTTTGAATTCCAACTGTGGACCTTTTATATGTGCCTTCACTTTAGCTGTTTGCCTTAATCTCTACAGCCTTGCTCTCCGGGGTGGTTAATAAAATGCAACACTTGGCATTTTTATGTTTTAAGAAAAACAGTATTTTATTTATAATAAAATCTGAATATTTGTAACCCTTT