Transcript asmbl_167020

Sequence
Transcript Sequence for observation asmbl_167020 of TGE0003009:
CGGGGCTCCGGCTCCGCCTTCTACCCCAAGCTAGAAAAAGGAAGAGTTCTAGCCTGAAAGGGAACTCGGGCGTCGTCCTGGCGTCCTCTCCGGATTGCGCCGCACCCTCGCTTCCTGCCAGGGAGGGGCTGCCGGGCTTTGGCGGCTCCCGAGCATCGAGAACGGGGCCAGAGCAGCTTCCTGCCTGCCCCCCGCGACCATAGAGCGCGGGCCCAGGGCGCCGCCCGCGGGTGGGGGACGTTCCCAGGACGGAAGTGGCCGAGAGAGTGTCGAAGGGAGGGCGAGGCCGGAGCCCGAGGGCGACCCGAGAAGCGGCGGGGCGGCGGGCCGGCGGGCGGGGCGCAGAGCCAGGCAGCGCAGGTATAGCCAGGCTGGAGAAAAGAAGCTGCCACCATGGTTGCACTTTCACTGAAGATCAGCATTGGGAATGTGGTGAAGACGATGCAGTTTGAGCCGTCTACCATGGTGTACGACGCCTGCCGCATCATTCGTGAGCGGATCCCAGAGGCCCCAGCTGGTCCTCCCAGCGACTTTGGGCTCTTTCTGTCAGATGATGACCCCAAAAAGGGTATATGGCTGGAGGCTGGGAAAGCTTTGGACTACTACATGCTCCGAAATGGGGACACTATGGAGTACAGGAAGAAACAGAGACCCCTGAAGATCCGTATGCTGGATGGAACTGTGAAGACGATCATGGTGGATGACTCTAAGACTGTCACTGACATGCTCATGACCATCTGTGCCCGCATTGGCATCACCAATCATGATGAATATTCATTGGTTCGAGAGCTGATGGAAGAGAAAAAGGAGGAAATAACAGGGACCTTAAGAAAGGACAAGACATTGCTGCGAGATGAAAAGAAGATGGAGAAACTAAAGCAGAAATTGCACACAGATGATGAGTTGAACTGGCTGGACCATGGTCGGACACTGAGGGAGCAGGGTGTAGAGGAGCACGAGACGCTGCTGCTGCGGAGGAAGTTCTTTTACTCAGACCAGAATGTGGATTCCCGGGACCCTGTACAGCTGAACCTCCTGTATGTGCAGGCACGAGATGACATCCTGAATGGCTCCCACCCTGTCTCCTTTGACAAGGCCTGTGAGTTTGCTGGCTTCCAATGCCAGATCCAGTTTGGGCCCCACAATGAGCAGAAGCACAAGGCTGGCTTCCTTGACCTGAAGGACTTCCTGCCCAAGGAGTATGTGAAGCAGAAGGGAGAGCGTAAGATCTTCCAGGCACACAAGAATTGTGGGCAGATGAGTGAGATTGAGGCCAAGGTCCGCTACGTGAAGCTAGCCCGTTCTCTCAAGACTTACGGTGTCTCCTTCTTCCTGGTGAAGGAAAAAATGAAAGGGAAGAACAAGCTAGTGCCCAGGCTTCTGGGCATCACCAAGGAGTGTGTGATGCGAGTGGATGAGAAGACCAAGGAAGTGATCCAGGAGTGGAACCTCACCAACATCAAACGCTGGGCTGCGTCTCCCAAAAGCTTCACCCTGGATTTTGGAGATTACCAAGATGGCTATTACTCAGTACAGACAACTGAAGGGGAGCAGATTGCACAGCTCATTGCCGGCTACATCGATATCATCCTGAAGAAGAAAAAAAGCAAGGATCACTTTGGGCTGGAAGGAGATGAGGAGTCTACTATGCTGGAGGACTCAGTGTCCCCCAAAAAGTCAACAGTCCTGCAGCAGCAATACAACCGGGTGGGGAAAGTGGAGCATGGCTCTGTGGCCCTGCCTGCCATCATGCGCTCTGGAGCCTCTGGTCCTGAGAATTTCCAGGTGGGCAGCATGCCCCCTGCCCAGCAGCAGATTACCAGCGGCCAGATGCACCGAGGACACATGCCTCCTCTGACTTCAGCCCAGCAGGCACTCACTGGAACCATTAACTCCAGCATGCAGGCCGTGCAGGCTGCCCAGGCCACCCTGGATGACTTTGACACTCTGCCGCCTCTTGGCCAGGATGCTGCCTCTAAGGCCTGGCGTAAAAACAAGATGGATGAATCAAAGCATGAGATCCACTCTCAGGTAGATGCCATCACAGCTGGTACTGCGTCTGTGGTGAACCTGACAGCAGGGGACCCTGCTGAGACAGACTATACCGCAGTGGGCTGTGCAGTCACCACAATCTCCTCCAACCTGACGGAGATGTCCCGTGGGGTGAAGCTGCTGGCTGCCTTGCTGGAGGACGAAGGCGGCAGTGGTCGGCCCCTGTTGCAGGCAGCAAAGGGCCTTGCGGGAGCAGTGTCAGAACTGCTGCGCAGTGCCCAACCAGCCAGTGCTGAGCCCCGTCAGAACCTGCTGCAAGCAGCTGGGAACGTGGGCCAGGCCAGTGGGGAGCTGTTGCAACAAATTGGGGAAAGTGATACTGACCCCCACTTCCAGGATGCGCTAATGCAGCTCGCCAAAGCTGTGGCAAGTGCTGCAGCTGCCCTGGTCCTCAAGGCCAAGAGTGTGGCCCAGCGGACAGAGGACTCGGGACTTCAGACCCAAGTTATTGCTGCAGCAACACAGTGTGCCCTATCCACTTCCCAACTAGTGGCCTGTACTAAGGTGGTGGCACCTACAATCAGCTCACCTGTCTGCCAAGAGCAACTGGTGGAGGCTGGACGACTGGTAGCCAAAGCCGTGGAGGGCTGTGTGTCTGCCTCCCAGGCAGCTACAGAGGATGGGCAACTGTTGCGAGGGGTAGGAGCAGCAGCCACAGCTGTCACCCAGGCCCTAAATGAGCTGCTGCAGCATGTGAAAGCCCATGCCACAGGGGCTGGGCCTGCTGGCCGTTATGACCAGGCTACTGACACCATCCTAACCGTCACTGAGAACATCTTTAGCTCCATGGGTGATGCTGGGGAGATGGTGCGACAGGCCCGCATCCTGGCCCAAGCCACATCTGACCTGGTCAATGCCATCAAGGCTGATGCTGAGGGGGAAAGTGATCTGGAGAACTCCCGCAAGCTCTTAAGTGCTGCCAAGATCCTAGCTGATGCCACAGCCAAGATGGTAGAGGCTGCCAAGGGAGCAGCTGCCCACCCTGACAGTGAGGAGCAGCAGCAGCGGCTGCGGGAGGCAGCTGAGGGGCTGCGCATGGCCACCAATGCAGCTGCGCAGAATGCCATCAAGAAAAAGCTGGTGCAGCGCCTGGAGCATGCAGCCAAGCAGGCTGCAGCCTCAGCCACACAGACCATCGCTGCAGCTCAGCACGCAGCCTCTACCCCCAAGGCCTCTGCCGGCCCCCAGCCCCTGCTGGTGCAGAGCTGCAAGGCAGTGGCAGAGCAGATTCCACTGCTGGTGCAGGGCGTCCGAGGAAGCCAAGCCCAGCCTGACAGCCCCAGCGCTCAGCTTGCCCTCATTGCTGCCAGCCAGAGCTTCCTGCAGCCAGGTGGGAAGATGGTGGCAGCTGCAAAGGCCTCAGTGCCAACGATTCAGGACCAGGCTTCAGCCATGCAGCTGAGTCAGTGTGCCAAGAACCTGGGCACCGCGCTGGCTGAACTCCGGACGGCTGCCCAGAAGGCTCAGGAAGCATGTGGACCTTTGGAGATGGATTCTGCACTGAGTGTGGTACAGAATCTAGAGAAAGATCTACAGGAAGTGAAGGCAGCAGCTCGAGATGGCAAGCTTAAACCCTTACCTGGGGAGACAATGGAGAAGTGTACCCAGGACCTGGGCAACAGCACCAAAGCCGTGAGCTCAGCCATCGCCCAGCTACTGGGAGAGGTTGCCCAGGGCAATGAGAATTATGCAGGTATTGCAGCTCGGGATGTGGCAGGTGGGCTGCGGTCACTGGCCCAGGCCGCTAGGGGAGTCGCTGCACTGACGTCAGATCCTGCAGTGCAGGCCATTGTACTTGATACGGCCAGTGATGTGCTGGACAAGGCCAGCAGCCTCATTGAGGAGGCGAAAAAGGCAGCTGGCCATCCAGGGGACCCTGAGAGCCAGCAGCGGCTTGCCCAGGTGGCTAAAGCAGTGACCCAGGCTCTGAACCGCTGTGTCAGCTGCCTACCTGGCCAGCGCGATGTGGATAATGCCCTGAGGGCAGTTGGAGATGCCAGCAAGCGACTCCTGAGTGACTCGCTTCCTCCTAGCACTGGGACATTTCAAGAAGCTCAGAGCCGGTTGAATGAAGCTGCTGCTGGGCTGAATCAGGCAGCCACAGAACTGGTGCAGGCCTCTCGGGGAACCCCTCAGGACCTGGCTCGAGCCTCAGGCCGATTTGGACAGGACTTCAGCACCTTCCTGGAAGCTGGTGTGGAGATGGCAGGCCAGGCTCCGAGCCAGGAGGACCGAGCCCAAGTTGTGTCCAACTTGAAGGGCATCTCCATGTCTTCAAGCAAACTTCTTCTGGCTGCCAAGGCCCTGTCCACGGACCCTGCTGCCCCTAACCTCAAGAGTCAGCTGGCTGCAGCTGCCAGGGCAGTAACTGACAGCATCAATCAGCTCATCACTATGTGCACCCAGCAGGCACCCGGCCAGAAGGAGTGTGATAACGCCCTGCGGGAATTGGAGACGGTCCGGGAACTCCTGGAGAACCCAGTCCAGCCCATCAATGACATGTCCTACTTTGGTTGCCTGGACAGTGTAATGGAGAACTCAAAGGTGCTGGGCGAGGCCATGACTGGCATCTCCCAAAATGCCAAGAACGGAAACCTGCCAGAGTTTGGAGATGCCATTTCCACAGCCTCAAAGGCACTTTGTGGCTTCACCGAGGCAGCTGCACAGGCTGCATATCTGGTTGGTGTCTCTGACCCCAATAGCCAAGCTGGACAGCAAGGGCTAGTGGAGCCCACACAGTTTGCCCGTGCAAACCAGGCAATTCAGATGGCCTGCCAGAGTTTGGGAGAGCCTGGCTGTACCCAGGCCCAGGTGCTCTCTGCAGCCACCATTGTGGCTAAACACACCTCTGCACTGTGTAACAGCTGTCGCCTGGCTTCTGCCCGTACCACCAATCCTACTGCCAAGCGCCAGTTTGTACAGTCAGCCAAGGAGGTGGCCAACAGCACAGCTAATCTTGTCAAGACCATCAAGGCGCTAGATGGGGCCTTCACAGAGGAGAACCGTGCCCAGTGCCGAGCAGCAACAGCCCCTCTGCTGGAGGCTGTGGACAATCTGAGTGCCTTTGCGTCCAACCCTGAGTTCTCCAGCATTCCTGCCCAGATCAGCCCTGAGGGTCGGGCTGCCATGGAGCCCATTGTGATCTCTGCCAAGACAATGTTAGAGAGTGCCGGGGGACTCATCCAGACAGCCCGGGCCCTCGCAGTCAATCCCCGGGACCCCCCGAGCTGGTCGGTGCTGGCCGGCCACTCCCGTACTGTCTCAGACTCCATCAAGAAGCTAATTACAAGCATGAGGGACAAGGCTCCAGGGCAGCTGGAGTGTGAAACGGCCATTGCAGCTCTGAACAGTTGTCTACGGGACCTAGACCAGGCTTCCCTCGCTGCAGTCAGCCAGCAGCTTGCTCCCCGTGAGGGAATCTCTCAAGAGGCCTTGCACACTCAGATGCTCACTGCAGTCCAAGAGATCTCCCATCTCATTGAGCCGCTGGCCAATGCTGCCCGGGCTGAAGCCTCCCAGCTGGGACACAAGGTGTCCCAGATGGCGCAGTACTTTGAGCCGCTCACCCTGGCTGCAGTGGGTGCTGCCTCCAAGACCCTGAGCCACCCGCAGCAGATGGCACTCCTGGACCAGACTAAAACATTGGCAGAGTCTGCCCTGCAGTTGCTATACACTGCCAAGGAGGCTGGTGGTAACCCAAAGCAAGCAGCTCACACCCAGGAAGCCCTGGAGGAGGCTGTGCAGATGATGACCGAGGCCGTAGAGGACCTGACAACAACCCTCAACGAGGCAGCCAGTGCTGCTGGGGTCGTGGGTGGCATGGTGGACTCCATCACCCAGGCCATCAACCAGCTAGATGAAGGACCAATGGGTGAACCAGAAGGTTCCTTCGTGGATTACCAAACAACTATGGTGCGGACAGCCAAGGCCATTGCAGTGACCGTTCAGGAGATGGTTACCAAGTCAAACACCAGCCCAGAGGAGCTGGGCCCTCTTGCTAACCAGCTGACCAGTGACTATGGCCGTCTGGCCTCGGAGGCCAAGCCTGCAGCGGTGGCTGCTGAAAATGAAGAGATAGGTTCCCATATCAAACACCGGGTACAGGAGCTGGGCCATGGCTGTGCCGCTCTGGTCACCAAGGCAGGCGCCCTGCAGTGCAGCCCCAGTGATGCCTACACCAAGAAGGAGCTCATAGAGTGTGCCCGGAGAGTCTCTGAGAAGGTCTCCCACGTCCTGGCTGCGCTCCAGGCTGGGAATCGTGGCACCCAGGCCTGCATCACAGCAGCCAGCGCTGTGTCTGGTATCATTGCTGACCTCGACACCACCATCATGTTCGCCACTGCTGGCACGCTCAATCGTGAGGGTACTGAAACTTTCGCTGACCACCGGGAGGGCATCCTGAAGACTGCGAAGGTGCTGGTGGAGGACACCAAGGTCCTGGTGCAAAACGCAGCTGGGAGCCAGGAGAAGTTGGCGCAGGCTGCCCAGTCCTCCGTGGCGACCATCACCCGCCTCGCTGATGTGGTCAAGCTGGGTGCAGCCAGCCTGGGAGCTGAGGACCCTGAGACCCAGGTGGTACTAATCAACGCAGTGAAAGATGTAGCCAAAGCCCTGGGAGACCTCATCAGTGCAACGAAGGCTGCAGCTGGCAAAGTTGGAGATGACCCTGCTGTGTGGCAGCTAAAGAACTCTGCCAAGGTGATGGTGACCAATGTGACATCATTGCTTAAGACAGTAAAAGCCGTGGAAGATGAGGCCACCAAAGGCACTCGGGCCCTGGAGGCAACCACAGAACACATACGGCAGGAGCTGGCGGTTTTCTGTTCCCCAGAGCCACCTGCCAAGACCTCTACCCCAGAAGACTTCATCCGAATGACCAAGGGTATCACCATGGCAACCGCCAAGGCCGTTGCTGCTGGCAATTCCTGTCGCCAGGAAGATGTCATTGCCACAGCCAATCTGAGCCGCCGTGCTATTGCAGATATGCTTCGGGCTTGCAAGGAAGCAGCTTACCACCCAGAAGTGGCCCCTGATGTGCGGCTTCGAGCCCTGCACTATGGCCGGGAGTGTGCCAATGGCTACCTGGAACTGCTGGACCATGTACTGCTGACCCTGCAGAAGCCAAGCCCAGAACTGAAGCAGCAGTTGACAGGACATTCAAAGCGTGTGGCTGGTTCCGTCACTGAGCTCATCCAGGCTGCTGAAGCCATGAAGGGAACAGAATGGGTAGACCCAGAGGACCCCACAGTCATTGCTGAGAATGAGCTCCTGGGAGCTGCAGCCGCCATTGAGGCTGCAGCCAAAAAGCTAGAGCAGCTGAAGCCCCGGGCCAAACCCAAGGAGGCAGATGAGTCCTTGAACTTTGAGGAGCAGATACTAGAAGCTGCCAAGTCCATTGCAGCAGCCACCAGTGCACTGGTAAAGGCTGCGTCGGCTGCCCAGAGAGAACTAGTGGCCCAAGGGAAGGTGGGTGCCATTCCAGCCAATGCACTGGACGATGGGCAGTGGTCCCAGGGCCTCATTTCTGCTGCCCGGATGGTGGCTGCGGCCACCAACAATCTGTGTGAGGCAGCCAATGCAGCTGTACAAGGCCATGCCAGCCAGGAGAAGCTCATCTCATCAGCCAAGCAGGTAGCTGCCTCCACAGCCCAGCTCCTTGTGGCCTGCAAGGTCAAGGCTGACCAGGACTCGGAGGCAATGAAACGACTTCAGGCTGCTGGCAACGCAGTGAAGCGAGCCTCAGATAATCTGGTGAAAGCAGCACAGAAGGCTGCAGCCTTTGAAGAGCAGGAGAATGAGACAGTGGTGGTGAAAGAGAAGATGGTTGGCGGCATTGCCCAGATCATCGCAGCACAGGAAGAAATGCTTCGGAAGGAACGAGAGCTGGAAGAGGCGCGGAAGAAACTGGCCCAGATCCGGCAGCAGCAGTACAAGTTTCTGCCTTCAGAGCTTCGAGATGAGCACTAAAGAAGCCTCTTCTATTTAATGCAGACCCGGCCCAGAGACTGTGCGTGCCACTACCAAAGCCTTCTGGGCTGTCGGGGCCCAACCTGCCCAACCCCAGCACTCCCCAAAGTGCCTGCCAAACCCCAGGGCCTGGCCCCGCCCAGTCCCGCAGTACATCCCCTGTCCCCTCCCCAACCCCAAGTGCCTTCATGCCCTAGGGCCCCCCAAGTGCCTGCCCCTCCCCAGAGTATTAACGCTCCAAGAGTATTATTAACGCTGCTGTACCTCGATCTGAATCTGCCGGGGCCCCAGCCCACTCCACCCTGCCAGCAGCTTCCGGCCAGTCCCCACAGCCTCATCAGCTCTCTTCACCGTTTTTTGATACTATCTTCCCCCACCCCCAGCTACCCATAGGGGCTGCAGAGTTATAAGCCCCAAACAGGTCATGCTCCAATAAAAATGATTCTACCTACAACCTCTGCCTGGCTTCAAGGGAGATACAAGTTTTCTCCCAGGGCAGTAGGAGAGACAGTGGGGTTGAATTCTGTCACCCAGCTTGATCCAGCTTGAAATGGGAGAGGGGAAGACTGGCAGTCTGCACCTGAGGTCCCTTCCTCCTTGCACCCGGACCCTAAAGTTATCCAATGGGGAAGTTGTGCCTGAGAAGTCATACTCCTGTTATCCTCACCTCCCTGGCCAGCACCTAAGCCTCACAAAGTGTCGTTCTGCTGCTGCTGGGACAGCAGCTACCACAGTTCCTTGTGGCTACCAGGACATTCTGTTCTTCATAGCTACTCAGGGTATGTCAACAAATCCAGTCCTTGACCAAATTCAAATTTTCAAAAGAAGCTTTGCTAAAAATAATATGCCTGTAAGTGTCTGAGCCTAAGAGAACTATGGCCACAAAACTGATTGAAGCCATTAGCAAGCAGAAAAATCCCAACTTGAGGCTGCCTCGGGTAGGCACCGCTCTTGATTGGGTTGGGACACTCCTGCCTAGGGTAGCGCTAAAAGTGAAGAGCTTGACCCAGGTGTGAGAATTTATTGTTAGAGGGGGCAGAGCTCCCCTAGTGGCCAGGAAGGTGCTAGCAGCCCTGTTCCAGCCACCCTGCTTATCTGGTGGGTCAGTGGAAAGAGGCAGTCAGAGAGGTGGATGCTGTGTGCTTCCACGTCCCCATCCAGCCACTCTGTCCATAATGCATGGACTCTCTGACAGTCGTCTTAGGTTGGCAACTATTTTCATGCGTGATTCTTTAGTCAGCCCTACCGCCCAGTACATTATTTCCTCAAGTAGAACACAAACGCCACCCATCTGCTACTAACACCTTCTACTCCCACCACATTAGGGAAAGCTTGAAGTAGATGGAATGTAGCTGGTAACGGTGGTTCGAGCCTCTAATCCCAGCTACTTAAAAGGCTGAGGCAGGAGGACTGCTTGAGACCAGGAGT