Transcript asmbl_167018

Sequence
Transcript Sequence for observation asmbl_167018 of TGE0058585:
GGTGACGGTGCTCATCCCTGCAGATGGTGGGACTGCCTCCAAACTCTGTAGCCTTTGCCATCCTCCTCCAGCCCTCTCAGCCCTCTCCTGTTGTCACTTCTCCCAGGCATGGGCAACCTTTCCATTTCACATGGCACCTTCCACAGTCACCATGTGACATTCCCTACCCAGGTCTCCCACGTCCTGGCTGCGCTCCAGGCTGGGAATCGTGGCACCCAGGCCTGCATCACAGCAGCCAGCGCTGTGTCTGGTATCATTGCTGACCTCGACACCACCATCATGTTCGCCACTGCTGGCACGCTCAATCGTGAGGGTACTGAAACTTTCGCTGACCACCGGGAGGGCATCCTGAAGACTGCGAAGGTGCTGGTGGAGGACACCAAGGTCCTGGTGCAAAACGCAGCTGGGAGCCAGGAGAAGTTGGCGCAGGCTGCCCAGTCCTCCGTGGCGACCATCACCCGCCTCGCTGATGTGGTCAAGCTGGGTGCAGCCAGCCTGGGAGCTGAGGACCCTGAGACCCAGGTGGTACTAATCAACGCAGTGAAAGATGTAGCCAAAGCCCTGGGAGACCTCATCAGTGCAACGAAGGCTGCAGCTGGCAAAGTTGGAGATGACCCTGCTGTGTGGCAGCTAAAGAACTCTGCCAAGGTGATGGTGACCAATGTGACATCATTGCTTAAGACAGTAAAAGCCGTGGAAGATGAGGCCACCAAAGGCACTCGGGCCCTGGAGGCAACCACAGAACACATACGGCAGGAGCTGGCGGTTTTCTGTTCCCCAGAGCCACCTGCCAAGACCTCTACCCCAGAAGACTTCATCCGAATGACCAAGGGTATCACCATGGCAACCGCCAAGGCCGTTGCTGCTGGCAATTCCTGTCGCCAGGAAGATGTCATTGCCACAGCCAATCTGAGCCGCCGTGCTATTGCAGATATGCTTCGGGCTTGCAAGGAAGCAGCTTACCACCCAGAAGTGGCCCCTGATGTGCGGCTTCGAGCCCTGCACTATGGCCGGGAGTGTGCCAATGGCTACCTGGAACTGCTGGACCATGTACTGCTGACCCTGCAGAAGCCAAGCCCAGAACTGAAGCAGCAGTTGACAGGACATTCAAAGCGTGTGGCTGGTTCCGTCACTGAGCTCATCCAGGCTGCTGAAGCCATGAAGGGAACAGAATGGGTAGACCCAGAGGACCCCACAGTCATTGCTGAGAATGAGCTCCTGGGAGCTGCAGCCGCCATTGAGGCTGCAGCCAAAAAGCTAGAGCAGCTGAAGCCCCGGGCCAAACCCAAGGAGGCAGATGAGTCCTTGAACTTTGAGGAGCAGATACTAGAAGCTGCCAAGTCCATTGCAGCAGCCACCAGTGCACTGGTAAAGGCTGCGTCGGCTGCCCAGAGAGAACTAGTGGCCCAAGGGAAGGTGGGTGCCATTCCAGCCAATGCACTGGACGATGGGCAGTGGTCCCAGGGCCTCATTTCTGCTGCCCGGATGGTGGCTGCGGCCACCAACAATCTGTGTGAGGCAGCCAATGCAGCTGTACAAGGCCATGCCAGCCAGGAGAAGCTCATCTCATCAGCCAAGCAGGTAGCTGCCTCCACAGCCCAGCTCCTTGTGGCCTGCAAGGTCAAGGCTGACCAGGACTCGGAGGCAATGAAACGACTTCAGGCTGCTGGCAACGCAGTGAAGCGAGCCTCAGATAATCTGGTGAAAGCAGCACAGAAGGCTGCAGCCTTTGAAGAGCAGGAGAATGAGACAGTGGTGGTGAAAGAGAAGATGGTTGGCGGCATTGCCCAGATCATCGCAGCACAGGAAGAAATGCTTCGGAAGGAACGAGAGCTGGAAGAGGCGCGGAAGAAACTGGCCCAGATCCGGCAGCAGCAGTACAAGTTTCTGCCTTCAGAGCTTCGAGATGAGCACTAAAGAAGCCTCTTCTATTTAATGCAGACCCGGCCCAGAGACTGTGCGTGCCACTACCAAAGCCTTCTGGGCTGTCGGGGCCCAACCTGCCCAACCCCAGCACTCCCCAAAGTGCCTGCCAAACCCCAGGGCCTGGCCCCGCCCAGTCCCGCAGTACATCCCCTGTCCCCTCCCCAACCCCAAGTGCCTTCATGCCCTAGGGCCCCCCAAGTGCCTGCCCCTCCCCAGAGTATTAACGCTCCAAGAGTATTATTAACGCTGCTGTACCTCGATCTGAATCTGCCGGGGCCCCAGCCCACTCCACCCTGCCAGCAGCTTCCGGCCAGTCCCCACAGCCTCATCAGCTCTCTTCACCGTTTTTTGATACTATCTTCCCCCACCCCCAGCTACCCATAGGGGCTGCAGAGTTATAAGCCCCAAACAGGTCATGCTCCAATAAAAATGATTCTACCTACAACCTCTGCCTGGCTTCAAGGGAGATACAAGTTTTCTCCCAGGGCAGTAGGAGAGACAGTGGGGTTGAATTCTGTCACCCAGCTTGATCCAGCTTGAAATGGGAGAGGGGAAGACTGGCAGTCTGCACCTGAGGTCCCTTCCTCCTTGCACCCGGACCCTAAAGTTATCCAATGGGGAAGTTGTGCCTGAGAAGTCATACTCCTGTTATCCTCACCTCCCTGGCCAGCACCTAAGCCTCACAAAGTGTCGTTCTGCTGCTGCTGGGACAGCAGCTACCACAGTTCCTTGTGGCTACCAGGACATTCTGTTCTTCATAGCTACTCAGGGTATGTCAACAAATCCAGTCCTTGACCAAATTCAAATTTTCAAAAGAAGCTTTGCTAAAAATAATATGCCTGTAAGTGTCTGAGCCTAAGAGAACTATGGCCACAAAACTGATTGAAGCCATTAGCAAGCAGAAAAATCCCAACTTGAGGCTGCCTCGGGTAGGCACCGCTCTTGATTGGGTTGGGACACTCCTGCCTAGGGTAGCGCTAAAAGTGAAGAGCTTGACCCAGGTGTGAGAATTTATTGTTAGAGGGGGCAGAGCTCCCCTAGTGGCCAGGAAGGTGCTAGCAGCCCTGTTCCAGCCACCCTGCTTATCTGGTGGGTCAGTGGAAAGAGGCAGTCAGAGAGGTGGATGCTGTGTGCTTCCACGTCCCCATCCAGCCACTCTGTCCATAATGCATGGACTCTCTGACAGTCGTCTTAGGTTGGCAACTATTTTCATGCGTGATTCTTTAGTCAGCCCTACCGCCCAGTACATTATTTCCTCAAGTAGAACACAAACGCCACCCATCTGCTACTAACACCTTCTACTCCCACCACATTAGGGAAAGCTTGAAGTAGATGGAATGTAGCTGGTAACGGTGGTTCGAGCCTCTAATCCCAGCTACTTAAAAGGCTGAGGCAGGAGGACTGCTTGAGACCAGGAGT