Transcript asmbl_167017

Sequence
Transcript Sequence for observation asmbl_167017 of TGE0058584:
CTCTCGGTTGTCCTTTGACCCTGACTTCCCAGATCTGTCCCCTTTCATTACTCCCAGGCTATGTGCCCACCTTTTCAGCCCTCCTTTACCAGACTTCTCCCTGCATCATTCCCCACTCTTCTGTCTGACTTCCCCTCTCACCTTGCAGCTTCCTCCTAGCACTGGGACATTTCAAGAAGCTCAGAGCCGGTTGAATGAAGCTGCTGCTGGGCTGAATCAGGCAGCCACAGAACTGGTGCAGGCCTCTCGGGGAACCCCTCAGGACCTGGCTCGAGCCTCAGGCCGATTTGGACAGGACTTCAGCACCTTCCTGGAAGCTGGTGTGGAGATGGCAGGCCAGGCTCCGAGCCAGGAGGACCGAGCCCAAGTTGTGTCCAACTTGAAGGGCATCTCCATGTCTTCAAGCAAACTTCTTCTGGCTGCCAAGGCCCTGTCCACGGACCCTGCTGCCCCTAACCTCAAGAGTCAGCTGGCTGCAGCTGCCAGGGCAGTAACTGACAGCATCAATCAGCTCATCACTATGTGCACCCAGCAGGCACCCGGCCAGAAGGAGTGTGATAACGCCCTGCGGGAATTGGAGACGGTCCGGGAACTCCTGGAGAACCCAGTCCAGCCCATCAATGACATGTCCTACTTTGGTTGCCTGGACAGTGTAATGGAGAACTCAAAGGTGCTGGGCGAGGCCATGACTGGCATCTCCCAAAATGCCAAGAACGGAAACCTGCCAGAGTTTGGAGATGCCATTTCCACAGCCTCAAAGGCACTTTGTGGCTTCACCGAGGCAGCTGCACAGGCTGCATATCTGGTTGGTGTCTCTGACCCCAATAGCCAAGCTGGACAGCAAGGGCTAGTGGAGCCCACACAGTTTGCCCGTGCAAACCAGGCAATTCAGATGGCCTGCCAGAGTTTGGGAGAGCCTGGCTGTACCCAGGCCCAGGTGCTCTCTGCAGCCACCATTGTGGCTAAACACACCTCTGCACTGTGTAACAGCTGTCGCCTGGCTTCTGCCCGTACCACCAATCCTACTGCCAAGCGCCAGTTTGTACAGTCAGCCAAGGAGGTGGCCAACAGCACAGCTAATCTTGTCAAGACCATCAAGGCGCTAGATGGGGCCTTCACAGAGGAGAACCGTGCCCAGTGCCGAGCAGCAACAGCCCCTCTGCTGGAGGCTGTGGACAATCTGAGTGCCTTTGCGTCCAACCCTGAGTTCTCCAGCATTCCTGCCCAGATCAGCCCTGAGGGTCGGGCTGCCATGGAGCCCATTGTGATCTCTGCCAAGACAATGTTAGAGAGTGCCGGGGGACTCATCCAGACAGCCCGGGCCCTCGCAGTCAATCCCCGGGACCCCCCGAGCTGGTCGGTGCTGGCCGGCCACTCCCGTACTGTCTCAGACTCCATCAAGAAGCTAATTACAAGCATGAGGGACAAGGCTCCAGGGCAGCTGGAGTGTGAAACGGCCATTGCAGCTCTGAACAGTTGTCTACGGGACCTAGACCAGGCTTCCCTCGCTGCAGTCAGCCAGCAGCTTGCTCCCCGTGAGGGAATCTCTCAAGAGGCCTTGCACACTCAGATGCTCACTGCAGTCCAAGAGATCTCCCATCTCATTGAGCCGCTGGCCAATGCTGCCCGGGCTGAAGCCTCCCAGCTGGGACACAAGGTGTCCCAGATGGCGCAGTACTTTGAGCCGCTCACCCTGGCTGCAGTGGGTGCTGCCTCCAAGACCCTGAGCCACCCGCAGCAGATGGCACTCCTGGACCAGACTAAAACATTGGCAGAGTCTGCCCTGCAGTTGCTATACACTGCCAAGGAGGCTGGTGGTAACCCAAAGCAAGCAGCTCACACCCAGGAAGCCCTGGAGGAGGCTGTGCAGATGATGACCGAGGCCGTAGAGGACCTGACAACAACCCTCAACGAGGCAGCCAGTGCTGCTGGGGTCGTGGGTGGCATGGTGGACTCCATCACCCAGGCCATCAACCAGCTAGATGAAGGACCAATGGGTGAACCAGAAGGTTCCTTCGTGGATTACCAAACAACTATGGTGCGGACAGCCAAGGCCATTGCAGTGACCGTTCAGGAGATGGTTACCAAGTCAAACACCAGCCCAGAGGAGCTGGGCCCTCTTGCTAACCAGCTGACCAGTGACTATGGCCGTCTGGCCTCGGAGGCCAAGCCTGCAGCGGTGGCTGCTGAAAATGAAGAGATAGGTTCCCATATCAAACACCGGGTACAGGAGCTGGGCCATGGCTGTGCCGCTCTGGTCACCAAGGCAGGCGCCCTGCAGTGCAGCCCCAGTGATGCCTACACCAAGAAGGAGCTCATAGAGTGTGCCCGGAGAGTCTCTGAGAAGGTCTCCCACGTCCTGGCTGCGCTCCAGGCTGGGAATCGTGGCACCCAGGCCTGCATCACAGCAGCCAGCGCTGTGTCTGGTATCATTGCTGACCTCGACACCACCATCATGTTCGCCACTGCTGGCACGCTCAATCGTGAGGGTACTGAAACTTTCGCTGACCACCGGGAGGGCATCCTGAAGACTGCGAAGGTGCTGGTGGAGGACACCAAGGTCCTGGTGCAAAACGCAGCTGGGAGCCAGGAGAAGTTGGCGCAGGCTGCCCAGTCCTCCGTGGCGACCATCACCCGCCTCGCTGATGTGGTCAAGCTGGGTGCAGCCAGCCTGGGAGCTGAGGACCCTGAGACCCAGGTGGTACTAATCAACGCAGTGAAAGATGTAGCCAAAGCCCTGGGAGACCTCATCAGTGCAACGAAGGCTGCAGCTGGCAAAGTTGGAGATGACCCTGCTGTGTGGCAGCTAAAGAACTCTGCCAAGGTGATGGTGACCAATGTGACATCATTGCTTAAGACAGTAAAAGCCGTGGAAGATGAGGCCACCAAAGGCACTCGGGCCCTGGAGGCAACCACAGAACACATACGGCAGGAGCTGGCGGTTTTCTGTTCCCCAGAGCCACCTGCCAAGACCTCTACCCCAGAAGACTTCATCCGAATGACCAAGGGTATCACCATGGCAACCGCCAAGGCCGTTGCTGCTGGCAATTCCTGTCGCCAGGAAGATGTCATTGCCACAGCCAATCTGAGCCGCCGTGCTATTGCAGATATGCTTCGGGCTTGCAAGGAAGCAGCTTACCACCCAGAAGTGGCCCCTGATGTGCGGCTTCGAGCCCTGCACTATGGCCGGGAGTGTGCCAATGGCTACCTGGAACTGCTGGACCATGTACTGCTGACCCTGCAGAAGCCAAGCCCAGAACTGAAGCAGCAGTTGACAGGACATTCAAAGCGTGTGGCTGGTTCCGTCACTGAGCTCATCCAGGCTGCTGAAGCCATGAAGGGAACAGAATGGGTAGACCCAGAGGACCCCACAGTCATTGCTGAGAATGAGCTCCTGGGAGCTGCAGCCGCCATTGAGGCTGCAGCCAAAAAGCTAGAGCAGCTGAAGCCCCGGGCCAAACCCAAGGAGGCAGATGAGTCCTTGAACTTTGAGGAGCAGATACTAGAAGCTGCCAAGTCCATTGCAGCAGCCACCAGTGCACTGGTAAAGGCTGCGTCGGCTGCCCAGAGAGAACTAGTGGCCCAAGGGAAGGTGGGTGCCATTCCAGCCAATGCACTGGACGATGGGCAGTGGTCCCAGGGCCTCATTTCTGCTGCCCGGATGGTGGCTGCGGCCACCAACAATCTGTGTGAGGCAGCCAATGCAGCTGTACAAGGCCATGCCAGCCAGGAGAAGCTCATCTCATCAGCCAAGCAGGTAGCTGCCTCCACAGCCCAGCTCCTTGTGGCCTGCAAGGTCAAGGCTGACCAGGACTCGGAGGCAATGAAACGACTTCAGGCTGCTGGCAACGCAGTGAAGCGAGCCTCAGATAATCTGGTGAAAGCAGCACAGAAGGCTGCAGCCTTTGAAGAGCAGGAGAATGAGACAGTGGTGGTGAAAGAGAAGATGGTTGGCGGCATTGCCCAGATCATCGCAGCACAGGAAGAAATGCTTCGGAAGGAACGAGAGCTGGAAGAGGCGCGGAAGAAACTGGCCCAGATCCGGCAGCAGCAGTACAAGTTTCTGCCTTCAGAGCTTCGAGATGAGCACTAAAGAAGCCTCTTCTATTTAATGCAGACCCGGCCCAGAGACTGTGCGTGCCACTACCAAAGCCTTCTGGGCTGTCGGGGCCCAACCTGCCCAACCCCAGCACTCCCCAAAGTGCCTGCCAAACCCCAGGGCCTGGCCCCGCCCAGTCCCGCAGTACATCCCCTGTCCCCTCCCCAACCCCAAGTGCCTTCATGCCCTAGGGCCCCCCAAGTGCCTGCCCCTCCCCAGAGTATTAACGCTCCAAGAGTATTATTAACGCTGCTGTACCTCGATCTGAATCTGCCGGGGCCCCAGCCCACTCCACCCTGCCAGCAGCTTCCGGCCAGTCCCCACAGCCTCATCAGCTCTCTTCACCGTTTTTTGATACTATCTTCCCCCACCCCCAGCTACCCATAGGGGCTGCAGAGTTATAAGCCCCAAACAGGTCATGCTCCAATAAAAATGATTCTACCTACAACCTCTGCCTGGCTTCAAGGGAGATACAAGTTTTCTCCCAGGGCAGTAGGAGAGACAGTGGGGTTGAATTCTGTCACCCAGCTTGATCCAGCTTGAAATGGGAGAGGGGAAGACTGGCAGTCTGCACCTGAGGTCCCTTCCTCCTTGCACCCGGACCCTAAAGTTATCCAATGGGGAAGTTGTGCCTGAGAAGTCATACTCCTGTTATCCTCACCTCCCTGGCCAGCACCTAAGCCTCACAAAGTGTCGTTCTGCTGCTGCTGGGACAGCAGCTACCACAGTTCCTTGTGGCTACCAGGACATTCTGTTCTTCATAGCTACTCAGGGTATGTCAACAAATCCAGTCCTTGACCAAATTCAAATTTTCAAAAGAAGCTTTGCTAAAAATAATATGCCTGTAAGTGTCTGAGCCTAAGAGAACTATGGCCACAAAACTGATTGAAGCCATTAGCAAGCAGAAAAATCCCAACTTGAGGCTGCCTCGGGTAGGCACCGCTCTTGATTGGGTTGGGACACTCCTGCCTAGGGTAGCGCTAAAAGTGAAGAGCTTGACCCAGGTGTGAGAATTTATTGTTAGAGGGGGCAGAGCTCCCCTAGTGGCCAGGAAGGTGCTAGCAGCCCTGTTCCAGCCACCCTGCTTATCTGGTGGGTCAGTGGAAAGAGGCAGTCAGAGAGGTGGATGCTGTGTGCTTCCACGTCCCCATCCAGCCACTCTGTCCATAATGCATGGACTCTCTGACAGTCGTCTTAGGTTGGCAACTATTTTCATGCGTGATTCTTTAGTCAGCCCTACCGCCCAGTACATTATTTCCTCAAGTAGAACACAAACGCCACCCATCTGCTACTAACACCTTCTACTCCCACCACATTAGGGAAAGCTTGAAGTAGATGGAATGTAGCTGGTAACGGTGGTTCGAGCCTCTAATCCCAGCTACTTAAAAGGCTGAGGCAGGAGGACTGCTTGAGACCAGGAGT