Transcript asmbl_167015

Sequence
Transcript Sequence for observation asmbl_167015 of TGE0056463:
GGGAAGAGGGGGATGGGGGCGGGACCCCAAGGGAGGCGGTCCCCAGTGGGTGGGCGAAGGGGGCGGCCGCACCCCCCGGCCGGGCCGTGCTTCTGCCCCTACAAGGTTTGGGCCGAGGTGGGGGAGGGTCCTGGTTGCCGGCCCCGCCCGGTCCCTCCCCGCCTTTTAGGCGCCCGCGTGGCCGGGACGTCCCAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAGTCCGTCCGGTCCTCACCGCCTGCCGGCCGGCCCACCCCCCACCGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTGGACAAGGAGAACGCCATCGACCGCGCCGAGCAGGCCGAAGCCGACAAGAAGCAAGCTGAGGACCGCTGCAAGCAGCTGGAGGAGGAGCAGCAGGCCCTCCAGAAGAAGCTGAAGGGGACAGAGGATGAGGTGGAAAAGTATTCTGAATCCGTGAAGGAGGCCCAGGAGAAACTGGAGCAGGCCGAGAAGAAGGCCACTGATGCTGAGGCAGATGTGGCCTCCCTGAACCGCCGCATTCAGCTGGTTGAGGAGGAGCTGGACCGGGCCCAGGAGCGCCTGGCTACAGCCCTGCAGAAGCTGGAGGAGGCCGAGAAGGCGGCTGATGAGAGCGAGAGAGGAATGAAGGTCATCGAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAACTGCAGGAGATGCAGCTGAAGGAGGCCAAGCACATCGCTGAGGATTCAGACCGCAAATATGAAGAGGTGGCCAGGAAGCTGGTGATCCTGGAAGGAGAGCTGGAGCGCTCGGAGGAGAGGGCTGAGGTGGCCGAGAGCCGAGCCAGACAGCTGGAGGAGGAACTTCGAACCATGGACCAGGCCCTCAAGTCCCTGATGGCCTCAGAGGAGGAGTATTCCACCAAAGAAGATAAATATGAAGAGGAGATCAAACTGTTGGAGGAGAAGCTGAAGGAGGCTGAGACCCGAGCAGAGTTTGCCGAGAGGTCTGTGGCAAAGTTGGAGAAAACCATCGATGACCTAGAAGATGAAGTCTATGCCCAGAAGATGAAGTACAAGGCCATTAGCGAGGAACTGGACAACGCACTCAATGACATCACCTCCCTCTGAGCCCCACGCCAGCGTGGCCACCTCAGCTCTCTTCTCTCCTCTCCTTTCCATTCTCTCTATGGGGAGGGGAGCAGGCAGGAGGAGCAGAAATTGCCAACATTGCACAGCCAGGCTGGGAGCAGCCTAGGGAGAGCCCCCATCATGCCCACCACCCACTCTGGCACTGGCTTCATCCTTTACCTATCCCCTTCCACCCTCCTTTGCTGCTTAATAAATTCTGAACTTGGTCTCCATGCTGTTTTCCTGCCCTCCAGAGAGCACCTCTATCGCCACCACGGAGCACTGGTTCACTCCTGACACCCTGGCACTTACTGACACCCCCAGCCCCTGCACTGAGCCCACCCACAAAACACCATGGCCCACGCTGAAACCCCTCTGCACAGGCACTCCCTGGCTGTCGCTCTCTGATTCACCACTGCATGTGGGCACGTGTGGCCCCATCAAACCATGACCGCCTCTGGTGCCAATCCCTGACCTCAGAGCACTTAGCTGGGGTTCCAGGATCAAACAGAGTGACTGGAAAGGAAGTAGGGTGGTGAGGTGCAGGACAGGGGCAAGAAGGTTGCAAAAGGTCTGGAATGGAGCTTGGAAAAATGTTGGATATCAGCAACATGGGGCTTTCACTGCAGCAGCAGGTCTGTTTTCTACCTCAAGTCTGTCTGTCTGGCCCTTCCTTTCCTGGCGCAGTCTTTGTCTTACCTTCTGTCTCCAACTTCCTTAAACCTTCTAAAGAAGAGGATAAAGTAGTTTATGACTCAGCCCTCCCCACCCCACCTCTATGACCCCAAGGCCTTGAGTGAGGCATCCACGTCCGTCCTGTTCCCCTCATCCTAGTCAGTCCATCTGTTTGTCCCTGCCAAGGGGCCCTGAGGTCCGTGAATGCATGTGTCTTCCTTGACCCACTCCATGTCTATATGTCACCTTCCCCTGGCCCTGCCTCCCCACGTCTCCCCCTTGTGTCTCCCTTCTCCCTCACCTGCTGCTTCCCCTCACAGAGACCTTGGCCAGTGCCAAGG