Transcript asmbl_167014

Sequence
Transcript Sequence for observation asmbl_167014 of TGE0058120:
AGGAAGCTGGTGATCCTGGAAGGAGAGCTGGAGCGCTCGGAGGAGAGGGCTGAGGTGGCCGAGAGCCGAGCCAGACAGCTGGAGGAGGAACTTCGAACCATGGACCAGGCCCTCAAGTCCCTGATGGCCTCAGAGGAGGAGGTAGTGACCCCTCTGAACCTTTCTGGGCAATGGCGCCTTCTCTCAGCTCACCTTCCCTCCGTCTCAGCACCGCAGGCTGCTCTTTCTCAGCTGCTGGGGATCAGGAAGGGCCTGGGGCTTCTGAGCCCTGCCTGCTGTCACTCTCACAACTTTGCTCTTCTCTTCTCTCCTCCACCCGTCCCCTGCTGTGCCATCTCCACTGTCTGGCTTCGCTGTGCCCTCACACCCTGCCCCCCCCGCCACACACCCCCTGCAGTAAATGTGGGGACCTAGAGGAGGAGCTGAAAATTGTTACCAACAACTTGAAATCCCTGGAGGCCCAGGCGGACAAGTATTCCACCAAAGAAGATAAATATGAAGAGGAGATCAAACTGTTGGAGGAGAAGCTGAAGGAGGCTGAGACCCGAGCAGAGTTTGCCGAGAGGTCTGTGGCAAAGTTGGAGAAAACCATCGATGACCTAGAAGAGACCTTGGCCAGTGCCAAGGAGGAGAACGTCGAGATTCACCAGACCTTGGACCAGACCCTGCTGGAACTCAACAACCTGTGAGGGCCAGCCCCACCCCCAGCCAGGCTATGGTTGCCACCCCAACCCAATAAAACTGATGTTACTAGCC