Transcript asmbl_167012

Sequence
Transcript Sequence for observation asmbl_167012 of TGE0056466:
GGGAAGAGGGGGATGGGGGCGGGACCCCAAGGGAGGCGGTCCCCAGTGGGTGGGCGAAGGGGGCGGCCGCACCCCCCGGCCGGGCCGTGCTTCTGCCCCTACAAGGTTTGGGCCGAGGTGGGGGAGGGTCCTGGTTGCCGGCCCCGCCCGGTCCCTCCCCGCCTTTTAGGCGCCCGCGTGGCCGGGACGTCCCAGTCCCGCTCCGTCCTCCTCGCCTGCCACCGGTGCACCCAGTCCGCTCACCCAGCCCAGTCCGTCCGGTCCTCACCGCCTGCCGGCCGGCCCACCCCCCACCGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTGGACAAGGAGAACGCCATCGACCGCGCCGAGCAGGCCGAAGCCGACAAGAAGCAAGCTGAGGACCGCTGCAAGCAGCTGGAGGAGGAGCAGCAGGCCCTCCAGAAGAAGCTGAAGGGGACAGAGGATGAGGTGGAAAAGTATTCTGAATCCGTGAAGGAGGCCCAGGAGAAACTGGAGCAGGCCGAGAAGAAGGCCACTGATGCTGAGGCAGATGTGGCCTCCCTGAACCGCCGCATTCAGCTGGTTGAGGAGGAGCTGGACCGGGCCCAGGAGCGCCTGGCTACAGCCCTGCAGAAGCTGGAGGAGGCCGAGAAGGCGGCTGATGAGAGCGAGAGAGGAATGAAGGTCATCGAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAACTGCAGGAGATGCAGCTGAAGGAGGCCAAGCACATCGCTGAGGATTCAGACCGCAAATATGAAGAGGTGGCCAGGAAGCTGGTGATCCTGGAAGGAGAGCTGGAGCGCTCGGAGGAGAGGGCTGAGGTGGCCGAGAGCCGAGCCAGACAGCTGGAGGAGGAACTTCGAACCATGGACCAGGCCCTCAAGTCCCTGATGGCCTCAGAGGAGGAGTAAATGTGGGGACCTAGAGGAGGAGCTGAAAATTGTTACCAACAACTTGAAATCCCTGGAGGCCCAGGCGGACAAGTATTCCACCAAAGAAGATAAATATGAAGAGGAGATCAAACTGTTGGAGGAGAAGCTGAAGGAGGCTGAGACCCGAGCAGAGTTTGCCGAGAGGTCTGTGGCAAAGTTGGAGAAAACCATCGATGACCTAGAAGAGACCTTGGCCAGTGCCAAGGAGGAGAACGTCGAGATTCACCAGACCTTGGACCAGACCCTGCTGGAACTCAACAACCTGTGAGGGCCAGCCCCACCCCCAGCCAGGCTATGGTTGCCACCCCAACCCAATAAAACTGATGTTACTAGCC