Transcript asmbl_166741

Sequence
Transcript Sequence for observation asmbl_166741 of TGE0058583:
GTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGACAGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTACGTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGGCCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAACAACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTTGTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTACCCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTGGTGGAGCCCTACAACGCCACCCTCTCAGTCCACCAGCTCGTAGAAAACACAGACGAGACCTACTGCATTGATAACGAAGCTCTCTACGACATTTGCTTCAGAACCCTAAAGCTGACCACGCCCACCTATGGTGACCTGAACCACCTGGTGTCTGCTACCATGAGTGGGGTCACCACCTGCCTGCGCTTCCCAGGCCAGCTCAATGCTGACCTGCGGAAGCTGGCTGTGAACATGGTCCCGTTTCCCCGGCTGCACTTCTTCATGCCCGGCTTTGCCCCACTGACCAGCCGGGGCAGCCAGCAGTACCGGGCGCTGACCGTGCCCGAGCTCACCCAGCAGATGTTTGATGCCAAGAACATGATGGCTGCCTGCGACCCCCGCCATGGCCGCTACCTGACGGTTGCCGCCGTGTTCAGGGGCCGCATGTCCATGAAGGAGGTGGATGAGCAAATGCTTAATGTCCAAAACAAAAACAGCAGCTATTTTGTTGAGTGGATCCCCAACAATGTGAAAACGGCTGTCTGTGACATCCCACCTCGGGGGCTAAAAATGTCCGCCACCTTCATTGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCACGGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAATGACCTGGTGTCCGAGTACCAGCAGTACCAGGATGCCACAGCCGAGGAGGAGGGCGAGTTCGAGGAGGAGGCTGAGGAGGAGGTGGCCTAGAGCCTTCAGTCACTGGGGAAAGCAGGGAAGCAGTGTGAACTCTTTATTCACTCCCAGCCTGTCCTGTGGCCTGTCCCACTGTGTGCACTTGCTGTTTTCCCTGTCCACATCCATGCTGTACAGACACCACCATTAAAGCATTTTCATAGTG