Transcript asmbl_166740

Sequence
Transcript Sequence for observation asmbl_166740 of TGE0058582:
GTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGACAGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGTGAGGCCCCGGCCCCTTCCCCGACCGCCCTCCGGGGACCCCGCGGCCCCTGCCTTGGCTGACGCCCTCCCGTCCCCGCAGGCGGCAAGTACGTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGGCCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTCAGAGTGGTGCTGGGAACAACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTTGTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTACCCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTGGTGGAGCCCTACAACGCCACCCTCTCAGTCCACCAGCTCGTAGAAAACACAGACGAGACCTACTGCATTGATAACGAAGCTCTCTACGACATTTGCTTCAGAACCCTAAAGCTGACCACGCCCACCTATGGTGACCTGAACCACCTGGTGTCTGCTACCATGAGTGGGGTCACCACCTGCCTGCGCTTCCCAGGCCAGCTCAATGCTGACCTGCGGAAGCTGGCTGTGAACATGGTCCCGTTTCCCCGGCTGCACTTCTTCATGCCCGGCTTTGCCCCACTGACCAGCCGGGGCAGCCAGCAGTACCGGGCGCTGACCGTGCCCGAGCTCACCCAGCAGATGTTTGATGCCAAGAACATGATGGCTGCCTGCGACCCCCGCCATGGCCGCTACCTGACGGTTGCCGCCGTGTTCAGGGGCCGCATGTCCATGAAGGAGGTGGATGAGCAAATGCTTAATGTCCAAAACAAAAACAGCAGCTATTTTGTTGAGTGGATCCCCAACAATGTGAAAACGGCTGTCTGTGACATCCCACCTCGGGGGCTAAAAATGTCCGCCACCTTCATTGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCACGGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAATGACCTGGTGTCCGAGTACCAGCAGTACCAGGATGCCACAGCCGAGGAGGAGGGCGAGTTCGAGGAGGAGGCTGAGGAGGAGGTGGCCTAGAGCCTTCAGTCACTGGGGAAAGCAGGGAAGCAGTGTGAACTCTTTATTCACTCCCAGCCTGTCCTGTGGCCTGTCCCACTGTGTGCACTTGCTGTTTTCCCTGTCCACATCCATGCTGTACAGACACCACCATTAAAGCATTTTCATAGTG