Transcript asmbl_166739

Sequence
Transcript Sequence for observation asmbl_166739 of TGE0056732:
CCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCCGCCGCCGCCATCATGAGGGAAATCGTGCACTTGCAGGCCGGGCAGTGCGGCAACCAAATCGGCGCCAAGTTTTGGGAGGTGATCAGCGATGAGCACGGCATCGACCCCACGGGCACCTACCACGGGGACAGCGACCTGCAGCTGGAACGCATCAACGTGTACTACAATGAGGCCACCGGCGGCAAGTACGTGCCCCGCGCCGTGCTCGTGGATCTGGAGCCCGGCACCATGGACTCCGTGCGCTCGGGGCCCTTCGGGCAGATCTTCCGGCCGGACAACTTCGTTTTCGGTGAGCCGTGGCTGGGGACTGGGCGGCGGCTCAAAGGTCAAGGGGCTGCTCCAAGGGCACCGCCGTGGGAACTGCGCAGCCGGGGCCCCTGGACGCCCTCCTCTTCTCTGAGCCACTCAATCCCCTCTACTAAATCGGCTTTGGGAGCAAGGTCCAGCTGTCTGCCGAGGCGAGGAGCCGCCACACACGTAATCTCCCTGCAGGGAGCTGAGCTGGGGCAGTGGCTGTTCCTCTGTCCTTGGGAATTGGCAGTGGCCCCCCCGGGGAGGGGTTTGTTAAGCTGTCAGGTTTGGCCCCTGACTTAATTCGTAGCAGGGCAGGCTGCCGTCTTTTGGCTTTGAAGGGTCCGTTTGCTCTACCTCCAGGGTGAATTCTGTGGTCAGCTCACACCATGTCACTCGGCTTTTTTCGCATGGCGGTGACCAGTAGTGCTGTCTACCTGGCTGACAAATGATTAGCTGTGTTCTCTCACAGGTCAGAGTGGTGCTGGGAACAACTGGGCCAAGGGGCACTACACAGAAGGCGCGGAGCTGGTGGACTCGGTGCTGGATGTTGTGAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGTCTGGGATGGGTACCCTCCTCATCAGCAAGATCCGGGAGGAGTACCCAGACAGGATCATGAACACGTTTAGTGTGGTGCCTTCGCCCAAAGTGTCAGACACAGTGGTGGAGCCCTACAACGCCACCCTCTCAGTCCACCAGCTCGTAGAAAACACAGACGAGACCTACTGCATTGATAACGAAGCTCTCTACGACATTTGCTTCAGAACCCTAAAGCTGACCACGCCCACCTATGGTGACCTGAACCACCTGGTGTCTGCTACCATGAGTGGGGTCACCACCTGCCTGCGCTTCCCAGGCCAGCTCAATGCTGACCTGCGGAAGCTGGCTGTGAACATGGTCCCGTTTCCCCGGCTGCACTTCTTCATGCCCGGCTTTGCCCCACTGACCAGCCGGGGCAGCCAGCAGTACCGGGCGCTGACCGTGCCCGAGCTCACCCAGCAGATGTTTGATGCCAAGAACATGATGGCTGCCTGCGACCCCCGCCATGGCCGCTACCTGACGGTTGCCGCCGTGTTCAGGGGCCGCATGTCCATGAAGGAGGTGGATGAGCAAATGCTTAATGTCCAAAACAAAAACAGCAGCTATTTTGTTGAGTGGATCCCCAACAATGTGAAAACGGCTGTCTGTGACATCCCACCTCGGGGGCTAAAAATGTCCGCCACCTTCATTGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCACGGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAATGACCTGGTGTCCGAGTACCAGCAGTACCAGGATGCCACAGCCGAGGAGGAGGGCGAGTTCGAGGAGGAGGCTGAGGAGGAGGTGGCCTAGAGCCTTCAGTCACTGGGGAAAGCAGGGAAGCAGTGTGAACTCTTTATTCACTCCCAGCCTGTCCTGTGGCCTGTCCCACTGTGTGCACTTGCTGTTTTCCCTGTCCACATCCATGCTGTACAGACACCACCATTAAAGCATTTTCATAGTG