Transcript asmbl_166504

Sequence
Transcript Sequence for observation asmbl_166504 of TGE0058580:
AGCTTTCCAAGCTGCTGAGCAAGCACCAGAAGCACCAGGCTTTTGAAGCAGAGCTGCATGCCAACGCTGACCGGATCCGTGGGGTTATCGACATGGGCAACTCCCTCATTGAACGTGGAGCCTGTGCCGGCAGTGAGGATGCTGTCAAGGCCCGCCTGGCTGCCTTAGCTGACCAGTGGCAGTTCTTGGTGCAAAAGTCAGCGGAAAAGAGCCAGAAACTGAAAGAAGCCAACAAGCAGCAGAACTTCAACACAGGGATCAAGGACTTTGACTTCTGGCTGTCTGAGGTGGAGGCCCTGCTGGCATCCGAAGATTATGGCAAAGACCTAGCTTCTGTGAACAACCTGCTGAAAAAGCATCAACTGCTGGAAGCAGATATATCTGCCCATGAGGATCGCCTGAAGGACCTGAACAGCCAGGCAGACAGCCTGATGACCAGCAGTGCCTTCGACACCTCCCAAGTAAAGGACAAGAGGGACACCATCAACGGGCGCTTCCAGAAGATCAAGAGCATGGCGGCCTCCCGGCGAGCCAAGCTGAATGAATCCCATCGCCTGCACCAGTTCTTCCGGGACATGGATGACGAGGAGTCCTGGATCAAGGAGAAGAAGCTGCTGGTGGGCTCAGAGGACTACGGCCGGGACCTAACCGGCGTGCAGAACCTGAGGAAGAAGCACAAGCGGCTGGAAGCAGAACTGGCTGCGCATGAGCCGGCTATTCAGGGTGTCCTGGACACTGGCAAGAAGCTGTCCGATGACAACACCATCGGGAAAGAGGAGATCCAGCAGCGGCTGGCGCAGTTTGTGGAGCACTGGAAAGAGCTGAAGCAGCTGGCAGCTGCCCGGGGTCAGCGGCTGGAAGAGTCCTTGGAATATCAGCAGTTTGTAGCCAATGTGGAAGAGGAAGAAGCCTGGATCAATGAGAAAATGACCCTGGTGGCCAGCGAAGATTATGGCGACACTCTTGCCGCCATCCAGGGCTTACTGAAGAAACATGAAGCTTTTGAGACAGACTTCACCGTCCACAAGGATCGCGTGAATGATGTCTGCACCAATGGACAAGACCTCATTAAGAAGAACAATCACCATGAGGAGAACATCTCTTCAAAGATGAAGGGCCTGAACGGGAAAGTGTCAGACCTGGAGAAAGCTGCAGCCCAGAGAAAGGCGAAGCTGGATGAGAACTCGGCCTTCCTTCAGTTCAACTGGAAGGCGGACGTGGTGGAGTCCTGGATCGGTGAAAAGGAGAACAGCTTGAAGACAGATGATTATGGCCGAGACCTGTCTTCTGTGCAGACGCTCCTCACCAAACAGGAAACTTTTGACGCTGGGCTGCAGGCCTTCCAGCAGGAAGGCATTGCCAACATCACTGCCCTCAAAGATCAGCTTCTCGCCGCCAAACACGTTCAGTCCAAGGCCATCGAGGCCCGGCACGCCTCCCTCATGAAGAGGTGGAGCCAGCTTCTGGCCAACTCAGCCGCCCGCAAGAAGAAGCTTCTGGAGGCTCAGAGTCACTTCCGCAAGGTGGAGGACCTCTTCCTGACCTTCGCCAAAAAGGCTTCTGCCTTCAACAGCTGGTTTGAAAATGCAGAGGAGGACTTAACAGACCCCGTGCGCTGCAACTCCTTGGAAGAAATCAAAGCTTTGCGCGAGGCCCACGACGCCTTCCGCTCCTCCCTCAGCTCTGCCCAGGCTGACTTCAACCAGCTGGCCGAGCTGGACCGCCAGATCAAGAGCTTCCGCGTAGCCTCCAACCCCTACACCTGGTTTACCATGGAGGCCCTGGAGGAGACCTGGAGGAACCTACAGAAAATCATCAAGGAGAGGGAGCTGGAGCTGCAGAAGGAACAGCGGCGGCAGGAGGAGAACGACAAGCTGCGCCAGGAGTTTGCCCAGCACGCCAACGCCTTCCACCAGTGGATCCAAGAGACCAGGACATACCTCCTCGATGGGTCCTGTATGGTGGAAGAGTCGGGGACCCTCGAATCCCAGCTTGAAGCTACCAAACGCAAGCACCAGGAAATCCGAGCCATGAGAAGTCAGCTCAAAAAGATCGAGGACCTGGGGGCCGCCATGGAGGAGGCCCTCATCCTGGACAACAAGTACACGGAGCACAGCACCGTGGGCCTCGCCCAGCAGTGGGACCAGCTGGACCAGCTGGGCATGCGCATGCAGCACAACCTGGAGCAGCAGATCCAGGCCAGGAACACAACAGGTGTGACTGAGGAGGCCCTCAAAGAATTCAGCATGATGTTTAAACACTTTGACAAGGACAAGTCTGGCAGGCTGAACCATCAGGAGTTCAAATCTTGCCTGCGCTCCCTGGGCTATGACCTGCCCATGGTGGAGGAAGGGGAACCTGACCCTGAGTTCGAGGCAATCCTGGACACGGTGGATCCGAACAGAGATGGCCATGTCTCCTTGCAAGAATACATGGCTTTCATGATCAGCCGCGAAACTGAGAACGTCAAGTCCAGCGAGGAGATTGAGAGCGCCTTCCGGGCCCTCAGCTCAGAGGGAAAGCCTTACGTGACCAAGGAGGAGCTCTACCAGAACCTGACCCGGGAACAAGCCGACTACTGCGTCTCCCACATGAAGCCCTACGTGGACGGCAAGGGCCGCGAGCTCCCCACCGCGTTCGACTACGTGGAGTTCACCCGCTCGCTTTTCGTGAACTGAGCCACTCCCTGGGTCACCCACCCCTCGCTGCTTGCCCTGCGTCGCCTTGCTGCATGTCCGCTCCTCTGTGTGCTCTCACTTTCCACTGTAACCTTAAGCCTGCTTAGCTTGGAATAAGACTTAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGGACCCAGATCTGTGTCTTGAAGCAGCTGCCCTCATTCCGACTTCAGAAAATCGAAGCAGCTGGCTCCTCCCCTTGTTCTCTCTCCCACCCTCCCCCAAATCTGTTTTCATGTAAAAGACAAATAAATGATGACTTCCCCCAAA