Transcript asmbl_166057

Sequence
Transcript Sequence for observation asmbl_166057 of TGE0058578:
GTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGGTAACAATAAATTTCTTTTTCTGGAATCTGTTTATGGAAGATGCAATTTTCTTTTTTGATGACAAATAAGAGAAAGTAAAAACAGAACCCTTTTTCAATATCACTCCTGTATCAAACAGATACAGTGTTCCTGACCCATTGTTATTTGTCAATTTGTCCAATTTTGTACAGCCGCTACTTTATCATATTTAATACATTTTGTGACTTGGGCATGTGGAACATAATTTTGTTATTTTCACTGCTTTTACTCCCCTAAAAGATTTGGAATATGTGTGGGAAAAGACATGCATAACAGAACAAATGAAATTAGAATG