Transcript asmbl_166056

Sequence
Transcript Sequence for observation asmbl_166056 of TGE0058577:
GTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGGTGTTGGAACTCGCCATAAGGCATTGATCAGGATTATGGTTTCCCGTTCTGAAATTGACATGAATGATATCAAAGCATTCTATCAGAAGATGTATGGTATCTCCCTTTGCCAAGCCATCCTGGTATGTTTTGATTCCTCTAATGCCATCCCAACAAATGAAAGTTCTTTTTGCAAGATCTTCAAGGAGAAGAGTTGACTTATTGTATCTATAAATTTAATATGTAAGATTAATTTAATATATTATGGTGTATACTTCATGAGTAAATTGAACTTTCACTGGTAAAATCTACTAGTGAGTTCTCTACTGAAATACTGGGTACATTTTTCAACTAAAGTCATGGAAACATTTAGTTTCCCATGCATAAATTCAGCAAGCAGAATATTCTAGTGTTCCCCCTAGGGTAGATAGACATTGTGGTTTATTTTGCCATTAATATTTGTCAGAGGATTAGAAACTCCTTATTCAAAATATTTATCTTAATTCTATCACATGTAAAATGTTTAAAATTTATGTTCAAATTGTCTCATAAGAATGTTAAAAAATAAGACAAAGAACAGTCAAGGGTTTTGGACTTACTGAAAGGTAGATAACGATTCAAATTTAATTAATTAGTCATATTGGATAACTAAAATCTACCCAGAAAATGTGAGAAAATTACAGGCACTATACATTTCTCTTCTTCTGGTGAGTGAATCAGGTATCTCCTCACATAAGATATGAGATTATATTGTGTTATACTTATTTAATTTTGTGTGATATTTCATTCATAGAAAATAATGGCACTAATATAAAACATAATTAATTCAGAAAAGTTTGTAATCTCAGTCTTGAAGGCTATTGCTTTTTTATGCAATGATAAAAAATCAGTTATCTGTTGTATATATTGTTTAATTAAGTGAATGGTAATGTGTAATCTCATCTACAGCTAAGTCTAAAAATAATTCTTCTATAAGTAAAAAAAAATAGAGAATTATGGTTTCGACTAACATTAAGTATACCTTTTTTTGAATCAACAGGATGAAACCAAAGGAGATTATGAGAAAATCCTGGTGGCTCTTTGTGGAGGAAACTAAACATTCCCTTGATGGTCTCAAGCTATGATCAGAAGACTTTAATTATATATTTTCATCCTATAAGCTTAAATAGGAAAGTTTCTTCAACAGGATTACAGTGTAGCTACCTACATGCTGAAAAATATAGCCTTTAAATCATTTTTATATTATAACTCTGTATAATAGAGATAAGTCCATTTTTTAAAAATGTTTTCCCCAAACCATAAAACCCTATACAAGTTGTTCTAGTAACAATACATGAGAAAGATGTCTATGTAGCTGAAAATAAAATGACGTCACAAGACA