Transcript asmbl_165588

Sequence
Transcript Sequence for observation asmbl_165588 of TGE0057690:
ATGAGGAGCGGGAAGGCCTCCTGCACCCTGGAGACCGTGTGGGAAGACAAGCACAAGTATGAGGAGGCCGAGCGGCGCTTCTACGAACACGAGGCCACACAGGCGGCCGCCTCCGCCCAGCAGCTGCCAGCCGAGGGGCCAGCCATGAATGGGCCCGGCCAGGACGACCCTGAGGACGCTGATGAGGCGGAAGCCCCTGACGGCGGCAGCAGGCGTGATCCCAGGAAGAGCCAGGACAGCAGGAAGCCCCTGCAGAAAAAGAGGAAGCGCTCCCCCAAGAGCGGGCTCGGCCCCGCGGACCTGGCCCTCCTGGGCCTCTCGGCCGAACGCGTGTGGCTGGACAAGTCACTTTTCGACCAGGCAGAGAGCTCCTACCGCCAGAAGCTGGCAGATGTGGCTGCCCAGGCAGCCTGGCCTCCTGCCTTGGCCCCTTGGGGTCTCTGCACCCATGGAAACCAGGTGGCCTGCCACCACGTGACCTGGGGGATCTGGGTCAACAAGTCCTCCTTCGACCAGGCTGAGCGGGCCTTCGTGGAGTGGTCTCAGGCCCTGTTGCTGGCCCCCGACGGCAGCCGCAGGCAGGGGACTCCCAACACAGGCCAGCAGGTGGCCGTCCCCGACCTGGCCCACCAGCCCAGCCCACCGGTCAATGGCCAGCCCCCGCTGGGCAGCCTGCAGGCACTGGTTCGGGAGGTGTGGCTGGAGAAGCCCCGGTATGATGCAGCCGAGAGGGGCTTCTACGAGGCCCTGTTTGACGGCCATCCCCCAGGGAAGGTGCGCCTGCAAGAGCGAGCCGGCCTGGCCGAGGGTGCCCGGCGGGGCCGCAGAGACCGGCGGGGCCGCAACATCTTAGGGAACAAGCGGGCCGGGCTGCGACGGGCCGATGGGGAGGCCCCCTCTGCCTTGCCCTACTGTTACTTCCTGCAGAAGGATGCAGAGGCCCCCTGGCTCAGCAAGCCTGCCTACGACAGCGCCGAGTGCCGCCACCACGCTGCCGAGGCCCTGCGGGTGGCCTGGTGCCTCGAAGCTGCCTCCCTGTCTCACCGACCCGGTCCTCGGTCTGGCCTGTCCGTGTCCAGCCTGAGACCCAACAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGC