Transcript asmbl_164272

Sequence
Transcript Sequence for observation asmbl_164272 of TGE0058574:
CGCCAGGACGCGGTTCATCTCCTCACTGAAGTAGCCGCGCTGGTAGGCCACGTCCACAGGCACGCGGTGGCTGTGCACGGGGTCGATGATGCCGCCCGTGGCGATCTGGGCCTCCAGCAGGCGGATGCCGTGCTGCCGGAGAACCAGGCCCTTCTGCATGGCCTGGAAGAGGGAGATGGTGCTGCCCGAGTAGGGGTCTCTGTAGCCGGTGACGGCCTTCTCGGCAGACAGCAGCTGCTCGTGAAGCTCGGGGCCCACCACGCCCGCCTTCACGGCCTCGTGGACATACAGGCGCTGGTTCCGCACGGGGTCCACCAGGAAGCCAGTGGCCGCCTGCGCCTCCAGCAGGAGCGCAGCCGTTGTGGCTCTCAGCAGGCCCCGGCGCATGGCCTCGTAGATGGACACCTTCTCCTTGGTGTCCTCCAGGTAGATGCCGGCGAGGCAGCCACTGCCCTGCAGCAGCGTCCGCACGGAGCCCAGCTCCGAAAGGTCCTTGACCGTCGTCTTGCCGTCCTTGAGCTGCTCAAACTGGGCTCTGCTGAGGACCCCGGAAGCCAGGAGCTCGCTGGCTGGCACAGGGGCACGGAGGCCGCTGAAGGACAGCCTCTCCTGCCGCAGGGTCTCCACCTCCTCCACGATGGTAATGAGAATCTTGATGACCTTCTCCACGGTGACCTTGCCCGTGCGGAACTGACGCAACAGCTCCTGCCGCTGCTCCGCAGTGAAGTACTCAGAGCTGATGAGCTCCCACACCGTCACCGTCCTGCCCTTGAAGCCACCCACGGGGACCTCAACCGGGGTCTTTTCAAAGGTCTCACGGGCCTGCAGCTCTGAGTAGAGCTCCTCCTGCCGGGCCCGAGCAGCCTTTTCTGAGAGCGGCAGCAGGCTCAGCCCGGTCAGCTGGTCGGGCCGGCACCGCTGCTGGAGCTCGCCGTAGGTGGCCGGCTCCCCTGTGCTGGGGTCACTGTAGGCCTTGGCGTCGGCCCTTGGTGCCGACAGGGCCCTGCTGGTCTCCTCATCCAGGCAGCCTCGGGCGCAGGCGACATCCAGGGGCACGCGGTGGCTCTTGCTGGGGTCCACGATGCCGCCCGTGGACAGCTGGGCGTCCAACAGGCGCAGGCCCTGCTCCCGGGGAATGAGGCCCTTCTTCAGGGCCTGGAACAGGGAGACGCTCTGCCCTGTGTAGGGGTCCCTGTACCCTGTCACAGCCTTCTCGGCTGATAGCAGCTTCTCATGAAACTCGGGGCCCACCAGGCCAGCACGCACTGCCTCGTCCACGGTCAGCCGGGCGCTGGTGGCGGGGTCGATGATGTGCCCGGTGCCGGCCTGGGCTTCCAACAGGGCCACGGCCATGTCGGATGGCAGCAGGTCTTTCTTCAGGGCATTGTAGATACTCAGCTTCTGCCCCGCCTCCTCCAGCCATACACCCGCGATGACGTTGGCACCCCGGAGAGCCCGCCGCACAGTGTCCACCTCGGCTACGTCTCGCACAGAGCGCTCACCTCGCTGCAGCTGCTGGTAGAGCTCGCGGTCGATGACCCTGCTCTCCAGCAGCTCGGCGGCTGGCACCAGGCTGCGCAGGCCCTCAAAGCAAAGCCGGCCCTTCTGCTCCTGCTCCTCCACCACCGTGATGATGATCTTGATGATCTTCTCCACTGTGATCCGGCCCGTGCGGAACTGCCGCAGCAGGTCCCGCCGCTGCTCTGCCGTGAAGTATTCCGAGTTGATGATCTCCCAAATGGTCACCGTCTTGCCCTGGAACTTGCCGAACGGCGCAGACACGGTGGCCTTCTCAAAGACGTCCCGGGCCTCGGAGTCAGTGTAGACCAGCTCCCCGCCCTTGGCAGCCTTATCCGTGAGTGGCAGAAGGCACAGGCCCGTCTCGGGGTCCTCCACGCAGCGCTCCAGT