Transcript asmbl_16376

Sequence
Transcript Sequence for observation asmbl_16376 of TGE0056086:
GGACAGGGGGAGCCAGTGGTGGAAGAAGGAGGAGGACCTATTAGAGCCTTTGCCCCGGCGTCGGTGACTCAGTGTTCGCGGGAGCGCCGCACCTACACCAGCCAACCCAGATCCCGAGGTCCGACAGCGCCCGGCCCAGATCCCCACGCCTGCCAGGAGCAAGCCGAGAGCCAGCCGGCCGGCGCACTCCGACTCCGAGCAGTCTCTGTCCTTCGACCCGAGCCCCGCGCCCTTTCCGGGACCCCTGCCCCGCGGGCAGCGCTGCCAACCTGCCGGCCATGGAGACCCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGGCCAGCTCCACTCCGCTGTCGCCCACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAATGATCGCTTGGCGGTCTACATCGACCGTGTGCGCTCGCTGGAAACGGAGAACGCAGGGCTGCGCCTTCGCATCACCGAGTCTGAAGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCGGGGATGCCCGCAAGACCCTTGACTCAGTAGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGTGAGGAGTTTAAGGAGCTGAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTATAAGAAGGAGCTGGAGAAGACTTATTCTGCCAAGCTGGACAATGCCAGGCAGTCTGCTGAGAGGAACAGCAACCTGGTGGGGGCTGCCCACGAGGAGCTGCAGCAGTCGCGCATCCGCATCGACAGCCTCTCTGCCCAGCTCAGCCAGCTCCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTTCGAGACCTGGAGGACTCACTGGCCCGTGAGCGGGACACCAGCCGGCGGCTGCTGGCGGAAAAGGAGCGGGAGATGGCCGAGATGCGGGCAAGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTTCTGGACATCAAGCTGGCCCTGGACATGGAGATCCACGCCTACCGCAAGCTCTTGGAGGGCGAGGAGGAGAGGCTACGCCTGTCCCCCAGCCCTACCTCGCAGCGCAGCCGTGGCCGTGCTTCCTCTCACTCATCCCAGACACAGGGTGGGGGCAGCGTCACCAAAAAGCGCAAACTGGAGTCCACTGAGAGCCGCAGCAGCTTCTCACAGCACGCACGCACTAGCGGGCGCGTGGCCGTGGAGGAGGTGGATGAGGAGGGCAAGTTTGTCCGGCTGCGCAACAAGTCCAATGAGGACCAGTCCATGGGCAATTGGCAGATCAAGCGCCAGAATGGAGATGATCCCTTGCTGACTTACCGGTTCCCACCAAAGTTCACCCTGAAGGCTGGGCAGGTGGTGACGGTGAGTGGCAGGGCGCTTGGGACTCTGGGGAGGCCTTGGGTGGCGATGGGAGCGCTGGGGTAAGTGTCCTTTTCTCCTCTCCAGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCTACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGCGGGAACAGCCTGCGTACGGCTCTCATCAACTCCACTGGGGAAGTAAGTAGGCCTGGGCCTGGCTGCTTGCTGGACGAGGCTCCCCCTGATGGCCAACATCGGAGCCAGCTGCCCCCAACCCAAGTTTGCCAATTCAGGGCCCCTTTCTAGAGCTCTCTGTTGCAGGCTCCAGACTTCTCCACCCAGTAGGCAAACCAAAAGATGCTTCCTCAACAGCACAAGGGGTGGAAGTTAGACAGTGAGGATTGTTAAAGGCAGAGCCATACTCCTACCCGGAGAGCTTGACAGTGTCCCTCTGGGGTGGAAATGAGTTCCTTAGCTCCATCACCACAGAGGACAGAGTAAGCAGCAGGCCGGACAAAGGGCAGGCCACAAGAAAAGTTGCAGGTGGTCACTGGGGTAGACATGCTGTACAACCCTTCCCTGGCCCTGACCCTTGGACCTGGTTCCATGTCCCCACCAGGAAGTGGC