Transcript asmbl_159658

Sequence
Transcript Sequence for observation asmbl_159658 of TGE0058569:
CTGGACAAAGAGCCGGCACGGGAGTGTGCCCAGCGCATCGCCGAGCAGCAGAAGGCACAGGCAGAGGTGGAGGGGCTGGGCAAGGGGGTCGCCCGGCTCTCTGCCGAGGCCGAGAAGGTCTTGGCCCTACCAGAGCCATCGCCTGCGGCCCCCACGCTGCGCTCGGAGCTGGAGCTGACGCTGGGCAAGCTGGAGCAGGTCCGCAGCCTGTCTGCCATCTACCTGGAGAAGCTCAAGACCATCAGCCTGGTGATCCGCGGCACGCAGGGGGCCGAGGAGGTGCTCAGGGCCCACGAGGAGCAGCTCAAGGAGGCCCAGGCCGTGCCGGCCACCCTCCCGGAGCTCGAGGCCACCAAGGCCTCTCTGAAGAAGCTGCGGGCCCAGGCCGAGGCACAGCAGCCCACGTTCGACGCCCTGCGGGATGAGCTGCGGGGGGCACAGGAGGTGGGGGAGCGACTGCAGCAGCGGCACGGGGAGCGGGACGTGGAGGTGGAGCGCTGGCGGGAGCGGGTCGCCCAGTTGCTTGAGCGCTGGCAGGCTGTGCTGGCCCAGACCGACGTGCGGCAGCGCGAGCTCGAGCAACTGGGCCGCCAGCTGCGTTACTACCGCGAGAGTGCAGACCCCTTGGGCGCCTGGCTGCAGGACGCCAGGCGGCGGCAGGAGCAGATCCAGGCCATGCCGCTGGCCGACAGCCAGGCTGTGCGGGAGCAGCTGCGGCAGGAGCAGGCCCTGCTGGAGGAGATCGAGCGCCACGGCGAGAAGGTCGAGGAGTGCCAGAGGTTTGCGAAACAGTACATCAACGCCATCAAGGACTATGAACTCCAGCTGGTGACGTACAAGGCGCAGCTTGAGCCGGTGGCCTCCCCGGCCAAGAAGCCCAAGGTCCAGTCGGGATCAGAGAGTGTCATCCAGGAGTACGTGGACCTGCGTACGCACTACAGCGAGCTGACCACACTGACGAGCCAGTACATCAAGTTCATCAGCGAGACTCTGCGGCGCATGGAGGAGGAGGAGATGCAGACGGTGCAGCAGGAGCAGCTGCTGCAGGAGACGCAGGCCCTGCAGCAAAGCTTCCTCTCTGAAAAGGACAGCCTGCTACAGCGGGAGCGCTTCATCGAGCAGGAGAAGGCCAAGCTGGAGCAGCTCTTCCAGGACGAGGTGGCCAAGGCACAGCAGCTGCGTGAGGAGCAGCAGCGGCAGCAGCAGCAGATGGAGCAGGAACGGCAGCGGCTGGTGGCCAGCATGGAGGAGGCGCGGCGGCGGCAGCATGAGGCCGAGGAGGGCGTGCGGCGCAAGCAGGAGGAGCTGCAGCAGCTGGAGCAGCAGCGGCGGCAGCAGGAGGAGCTGCTGGCTGAGGAGAACCAGAGGCTGCGTGAGCAGCTGCAGCTCCTGGAGGAGCAGCACCGGGCCGCGCTGGCGCACTCAGAGGAGGTCACTGCCTCGCAGGTGGCTGCCACAAAGACCCTGCCCAATGGCCGGGATGCACTTGATGGCCCCGCGGCAGAGGCAGAGCCGGAGCACAGCTTCGATGGCCTGCGGCGGAAGGTGTCAGCTCAGAGGCTGCAGGAGGCCGGCATCCTGAGTGCGGAGGAGCTGCAGCGGTTGGCGCAGGGCCACACCACGGTGGACGAGCTCGCACGGCGGGAAGACGTGCGCCACTACCTGCAGGGCCGCAGCAGTATCGCAGGGCTGTTGCTGAAGGCCACCAATGAGAAGCTGAGTGTTTACGCCGCCCTGCAGAGGCAGCTGCTGAGTCCCGGCACGGCCCTCATCCTGCTGGAGGCGCAGGCGGCCTCAGGCTTCCTGCTGGACCCTGTGCGGAACCGGCGGCTGACCGTCAACGAGGCTGTGAAGGAGGGTGTGGTGGGCCCCGAGCTGCACCACAAGCTGCTGTCGGCCGAGCGCGCCGTCACTGGCTACAAGGACCCCTACACTGGCCAGCAGATCTCTCTCTTCCAAGCCATGCAGAAGGGCCTCATCGTCCGGGAGCACGGCATCCGCCTGCTGGAGGCCCAGATCGCCACGGGCGGCGTTATCGACCCCGTGCACAGCCACCGCGTGCCCGTGGACGTGGCCTACCGGCGCGGCTACTTCGACGAGGAGATGAACCGCGTCCTGGCG