Transcript asmbl_159657

Sequence
Transcript Sequence for observation asmbl_159657 of TGE0058568:
TGGCGCAGCAGAAGAGCCTGGCGCAGGCCGAGGCTGAGAAGCAGAAGGAGGAGGCGGAGCGCGAGGCGCGGCGGCGCGGCAAGGCGGAGGAGCAGGCCGTCCGGCAGCGGGAGCTGGCTGAACAAGAGCTGGAGAAGCAGCGGCAGCTGGCGGAAGGCACCGCGCAGCAGCGCCTGGCCGCGGAGCAGGAGTTGATCCGGCTGCGGGCCGAGACGGAGCAGGGGGAGCAGCAGCGGCAGCTGCTGGAGGAGGAGCTGGCCCGGCTGCAGCGTGAGGCGGCTGCAGCCACGCAGAAACGGCAGGAGCTGGAAGCCGAGCTGGCCAAGGTGCGGGCCGAGATGGAGGTGCTGCTGGCCAGCAAGGCGAGGGCTGAGGAGGAGTCGCGCTCCACCAGCGAGAAGTCCAAGCAGAGGCTGGAGGCCGAGGCCGGCCGGTTCCGCGAGCTGGCCGAGGAGGCCGCCCGCCTGCGTGCCCTGGCGGAAGAGGCCAAGCGGCAGCGGCAGCTGGCCGAGGAAGACGCGGCGCGGCAGCGGGCCGAGGCGGAGCGGGTGCTTGCGGAGAAGCTGGCCGCCATCGGCGAGGCCACGCGGCTCAAGACGGAGGCGGAGATCGCGCTCAAGGAGAAGGAGGCGGAGAACGAGCGCCTGCGGCGGCTGGCGGAGGACGAGGCCTTCCAGCGGCGGCGGCTGGAGGAGCAGGCCGCGCAACACAAGGCTGACATCGAGGAGCGCCTGGCCCAGCTGCGCAAGGCATCGGACAGCGAGCTGGAGCGGCAGAAGGGGCTGGTGGAGGACACGCTGAGGCAGCGGCGGCAGGTGGAGGAGGAGATCCTGGCGCTGAAGGCGAGCTTCGAGAAGGCGGCCGCTGGCAAGGCGGAGCTGGAGCTGGAGCTGGGACGCATCCGCAGCAACGCGGAGGACACGCTGCGCAGCAAGGAGCAGGCCGAGCTGGAGGCTGCGAGGCAGCGGCAGCTGGCGGCGGAGGAGGAGCGGCGGCGCCGTGAGGCTGAGGAGCGCGTGCAGAAGAGCCTGGCGGCCGAGGAGGAGGCCGCACGGCAGCGGAAGGCGGCGCTGGAGGAAGTCGAGCGGCTGAAAGCCAAGGTGGAGGAGGCGCGGCGCCTGCGGGAGCGAGCGGAGCAGGAGTCGGCGCGGCAGCTGCAGCTGGCCCAGGAGGCCGCCCAGAAGCGGCTGCAGGCGGAAGAGAAGGCACACGCCTTCGCGGTGCAGCAGAAGGAGCAGGAGCTACAGCAGACGCTGCAGCAGGAGCAGAGCGTGCTGGACCAGCTGCGCGGCGAGGCGGAGGCGGCCCGGCGGGCGGCTGAGGAGGCGGAGGAGGCCCGGGTGCAGGCGGAGCGTGAGGCGGCGCAGTCCCGGCGGCAGGTGGAAGAGGCCGAGCGGCTGAAGCAGTCGGCAGAGGAGCAGGCACAGGCCCGGGCTCAGGCACAGGCGGCTGCAGAGAAGCTGCGCAAGGAGGCCGAGCAAGAGGCGGCGCGGCGGGCACAGGCGGAGCAGGCGGCCCTGCGGCAGAAGCAGGCAGCTGACGCGGAGATGGAGAAGCATAAGAAATTCGCCGAGCAGACGCTGCGGCAGAAGGCGCAGGTGGAGCAGGAGCTGACAACACTGCGGCTGCAGCTGGAGGAGACCGACCACCAGAAGAACCTGCTGGACGAGGAGCTGCAGCGGCTGAAGGCGGAGGCCACGGAGGCCGCACGCCAGCGCAGCCAGGTGGAGGAGGAGCTCTTCTCGGTGCGCGTGCAGATGGAGGAGCTGAGCAAGCTCAAGGCACGCATCGAGGCTGAGAACCGCGCACTCATCTTGCGTGACAAGGACAATACGCAGCGCTTCCTGCAGGAGGAGGCTGAGAAGATGAAGCAGGTGGCGGAGGAGGCCGCGCGGCTGAGTGTGGCGGCCCAAGAGGCTGCGCGACTGCGGCAGCTGGCAGAGGAGGACCTGGCACAGCAGCGGGCCTTGGCAGAGAAGATGCTCAAGGAGAAGATGCAGGCGGTGCAGGAGGCCACGCGACTCAAGGCTGAGGCGGAACTGCTGCAGCAGCAGAAGGAGCTTGCGCAGGAGCAGGCGCGGCGGCTGCAGGAGGACAAGGAGCAGATGGCGCAGCAGCTGGCGGAGGAGACGCAGGGCTTCCAGCGGACGCTGGAGGCCGAGCGGCAGCGGCAGCTGGAGATGAGCGCTGAGGCTGAGCGCCTCAAGCTGCGTGTGGCCGAGATGAGCCGAGCCCAGGCCCGCGCTGAGGAGGACGCCCAGCGCTTCCGGAAGCAGGCGGAGGAGATCGGTGAGAAGCTGCACCGCACGGAGCTCGCCACCCAGGAGAAGGTGACCCTGGTGCAGACACTGGAGATCCAGCGACAGCAGAGTGACCATGATGCCGAGCGCCTGCGGGAGGCCATCGCTGAGCTGGAGCGTGAGAAGGAGAAGCTCCAACAGGAGGCCAAACTGCTGCAGCTCAAGTCTGAGGAGATGCAGACGGTGCAGCAGGAGCAGCTGCTGCAGGAGACGCAGGCCCTGCAGCAAAGCTTCCTCTCTGAAAAGGACAGCCTGCTACAGCGGGAGCGCTTCATCGAGCAGGAGAAGGCCAAGCTGGAGCAGCTCTTCCAGGACGAGGTGGCCAAGGCACAGCAGCTGCGTGAGGAGCAGCAGCGGCAGCAGCAGCAGATGGAGCAGGAACGGCAGCGGCTGGTGGCCAGCATGGAGGAGGCGCGGCGGCGGCAGCATGAGGCCGAGGAGGGCGTGCGGCGCAAGCAGGAGGAGCTGCAGCAGCTGGAGCAGCAGCGGCGGCAGCAGGAGGAGCTGCTGGCTGAGGAGAACCAGAGGCTGCGTGAGCAGCTGCAGCTCCTGGAGGAGCAGCACCGGGCCGCGCTGGCGCACTCAGAGGAGGTCACTGCCTCGCAGGTGGCTGCCACAAAGACCCTGCCCAATGGCCGGGATGCACTTGATGGCCCCGCGGCAGAGGCAGAGCCGGAGCACAGCTTCGATGGCCTGCGGCGGAAGGTGTCAGCTCAGAGGCTGCAGGAGGCCGGCATCCTGAGTGCGGAGGAGCTGCAGCGGTTGGCGCAGGGCCACACCACGGTGGACGAGCTCGCACGGCGGGAAGACGTGCGCCACTACCTGCAGGGCCGCAGCAGTATCGCAGGGCTGTTGCTGAAGGCCACCAATGAGAAGCTGAGTGTTTACGCCGCCCTGCAGAGGCAGCTGCTGAGTCCCGGCACGGCCCTCATCCTGCTGGAGGCGCAGGCGGCCTCAGGCTTCCTGCTGGACCCTGTGCGGAACCGGCGGCTGACCGTCAACGAGGCTGTGAAGGAGGGTGTGGTGGGCCCCGAGCTGCACCACAAGCTGCTGTCGGCCGAGCGCGCCGTCACTGGCTACAAGGACCCCTACACTGGCCAGCAGATCTCTCTCTTCCAAGCCATGCAGAAGGGCCTCATCGTCCGGGAGCACGGCATCCGCCTGCTGGAGGCCCAGATCGCCACGGGCGGCGTTATCGACCCCGTGCACAGCCACCGCGTGCCCGTGGACGTGGCCTACCGGCGCGGCTACTTCGACGAGGAGATGAACCGCGTCCTGGCG