Transcript asmbl_159633

Sequence
Transcript Sequence for observation asmbl_159633 of TGE0058100:
AGGTGTGAGCCACCGTGCCTGGCCGAGGCTCCTTCTTTTATGAGGAGCGGGAAGGCCTCCTGCACCCTGGAGACCGTGTGGGAAGACAAGCACAAGTATGAGGAGGCCGAGCGGCGCTTCTACGAACACGAGGCCACACAGGCGGCCGCCTCCGCCCAGCAGCTGCCAGCCGAGGGGCCAGCCATGAATGGGCCCGGCCAGGACGACCCTGAGGACGCTGATGAGGCGGAAGCCCCTGACGGCGGCAGCAGGCGTGATCCCAGGAAGAGCCAGGACAGCAGGAAGCCCCTGCAGAAAAAGAGGAAGCGCTCCCCCAAGAGCGGGCTCGGCCCCGCGGACCTGGCCCTCCTGGGCCTCTCGGCCGAACGCGTGTGGCTGGACAAGTCACTTTTCGACCAGGCAGAGAGCTCCTACCGCCAGAAGCTGGCAGATGTGGCTGCCCAGGCAGCCTGGCCTCCTGCCTTGGCCCCTTGGGGTCTCTGCACCCATGGAAACCAGGTGGCCTGCCACCACGTGACCTGGGGGATCTGGGTCAACAAGTCCTCCTTCGACCAGGCTGAGCGGGCCTTCGTGGAGTGGTCTCAGGCCCTGTTGCTGGCCCCCGACGGCAGCCGCAGGCAGGGGACTCCCAACACAGGCCAGCAGGTGGCCGTCCCCGACCTGGCCCACCAGCCCAGCCCACCGGTCAATGGCCAGCCCCCGCTGGGCAGCCTGCAGGCACTGGTTCGGGAGGTGTGGCTGGAGAAGCCCCGGTATGATGCAGCCGAGAGGGGCTTCTACGAGGCCCTGTTTGACGGCCATCCCCCAGGGAAGGTGCGCCTGCAAGAGCGAGCCGGCCTGGCCGAGGGTGCCCGGCGGGGCCGCAGAGACCGGCGGGGCCGCAACATCTTAGGGAACAAGCGGGCCGGGCTGCGACGGGCCGATGGGGAGGCCCCCTCTGCCTTGCCCTACTGTTACTTCCTGCAGAAGGATGCAGAGGCCCCCTGGCTCAGCAAGCCTGCCTACGACAGCGCCGAGTGCCGCCACCACGCTGCCGAGGCCCTGCGGGTGGCCTGGTGCCTCGAAGCTGCCTCCCTGTCTCACCGACCCGGTCCTCGGTCTGGCCTGTCCGTGTCCAGCCTGAGACCCAACAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGC