Transcript asmbl_159631

Sequence
Transcript Sequence for observation asmbl_159631 of TGE0058567:
GGCCCGGGCGGCCCTCCCTTTCATCAGTCTTCCCGCGTCCGCCGATTCCTCCTCCTTGGTCGCCGCGTCCTTGGCTGGCGTCAGAAAAATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGTGTGTGTACGTGCGCGCGTGCGTGAGGCCCTGCCACGATTAAAGACTGAGACCGGC