Transcript asmbl_159332

Sequence
Transcript Sequence for observation asmbl_159332 of TGE0056079:
GCACCCTCCTGAAAACTGCAGCTTCCTTCTCACCTTGAAGAATAATCCTAGAAAACTCACAAAATGTGTGATGCTTTTGTAGGTACCTGGAAACTTGTCTCCAGTGAAAACTTTGATGATTATATGAAAGAAGTAGGAGTGGGCTTTGCCACCAGGAAAGTGGCTGGCATGGCCAAACCTAACATGATCATCAGTGTGAATGGGGATGTGATCACCATTAAATCTGAAAGTACCTTTAAAAATACTGAGATTTCCTTCATACTGGGCCAGGAATTTGACGAAGTCACTGCAGATGACAGGAAAGTCAAGAGCACCATAACCTTAGATGGGGGTGTCCTGGTACATGTGCAGAAATGGGATGGAAAATCAACCACCATAAAGAGAAAACGAGAGGATGATAAACTGGTGGTGGAATGCGTCATGAAAGGCGTCACTTCCACGAGAGTTTATGAGAGAGCATAAGCCAAGGGACGTTGACCTGGACTGAAGTTCGCATTGAACTCTACAACATTCTGTGGGATATATTGTTCAAAAAGATATTGTTGTTTTCCATGATTTAGCAAGCAACTAATTTTCTCCCAAGCTGATTTTATTCAATATGGTTACGTTGGTTAAATAAACTTTTTTTAGATTTAGAAGGTGATGTAATGATGTATTCATTGTGCTTATGATGTATTCTTAGTCATAACTGAGTGAAGGAAATGGGAAATTTGCATTATTTCTTTGTTCTGATATGAATAATAACATATTTCATAATAATTCAAGGTAAAAAGGGATATCTATGGATTTCCCTAGGTAGGAGATAACAAGTATGTACCATTACTGAATATTAAATCCTTCTTTACCATAGCTACAGTTAAGTAGGTGTATCTCAGAAACCTAAGGTAGTTTTAAATGTAGTGAAATTGTCCACAGCAAGCTGGCCCAAGTGCTCACATTTTATACCCGCTCTGTCTTAGTGCGTTGCAAGAGAGGAGTATATACAGTAGTTCCCCCTTATCCACAGGGGTACATTCTAAGACCCCCGGTGGGTGACTGAAACCACAGATAGTACCGAATCTTATACATACTATGTTTTTTTTCTAAACATAAATACCTACAATAAAGTTTAATTTTTAAATTAGGCACCATAATTAATAATAAAACAGAACAGTTATAACAATATACTATAATAAAATTATGTGTATGTGATCTCTCTTTCTCTCTCCCTCTCAAAATATTTTTAATATCTCTCCAGAATTCAGTGCAAATAATTCCATCATACTCACTTCAGAAAAGTGAAGATAGTCTTGTACATGAGTAGATTCAAATTTTATTGTCGTGGTTTCCAAAGTTTTATTTTTCTCACCAATGGAACTTTTGATTCAAATAAAATATCCAAGGGATTTCAGCTTATAAAACACACAAAATTGATAATGAGTTTTCCAAGGTACTGTGTGTGTGAATGTGTATGTCTGTGTATGTGTGTGTCGTCTGTATGTTTTTCCCACCTCTTGTAGAAGCTACGAAGCACCTTTCCATATTATTGAGGTTTCCTGTACGTAGACTGAAATTTACAAATCACATGCTTACATTTTATAGTAAGACAAAATCTGCCAAAGTGTATATTGCTGTTGATATAATTCTGTTTGTGATTCTCTCTTTAAAAATAAATCCAAAGGTTTTCATTTCCTGCATACTTATCCTATGCATAACACCATGATATGCAGAGGCCAGAAGAGATGGACTAGTTCAC