Transcript asmbl_159297

Sequence
Transcript Sequence for observation asmbl_159297 of TGE0057684:
TAGTCGTCGGAGGCCGGGCCTCTTGGTTGAAATAGGGAAAAACGTATTGCTATTGTCATATTTGTGATTGCGTTTTAGGCAACATGGTGTTAAAGGTTATTGACATGGAGCTAAAATATGCATCGTACACTGTAGCATGCCAGAGCAAGTAAAGTTACTAGTGACTAAAGTCAGTGACAGCATTTCTGGTAAACAACACTGCTCAGTACGGGAGTAATACAGCGCTGTGAGCTTTTTGAGCTATTGATAACATTTTTGTTTATTAACGTTAGAGAGAAGAAGAAGGAGGTTCCTGCTGTGCCAGAAACCCTTAAGAAAAAGCGAAGGAATTTCGCAGAGCTGAAGATCAAGCGCCTGAGAAAGAAGTTTGCCCAAAAGATGCTTCGAAAGGCAAGGAGGAAGCTTATCTATGAAAAAGCAAAGCACTATCACAAGGAATATAGGCAGATGTACAGAACTGAAATTCGAATGGCGAGGATGGCAAGAAAAGCTGGCAACTTCTATGTACCTGCAGAACCCAAATTGGCGTTTGTCATCAGAATCAGAGGTATCAATGGAGTGAGCCCAAAGGTTCGAAAGGTGTTGCAGCTTCTTCGCCTTCGTCAAATCTTCAATGGAACCTTTGTGAAGCTCAACAAGGCTTCGATTAACATGCTGAGGATTGTAGAGCCATATATTGCATGGGGGTACCCCAATCTGAAGTCAGTAAATGAACTAATCTACAAGCGTGGTTATGGCAAAATCAATAAGAAGCGAATTGCTTTGACAGATAACGCTTTGATTGCTCGATCTCTTGGTAAATACGGCATCATCTGCATGGAGGATTTGATTCATGAGATCTATACTGTTGGAAAACGCTTCAAAGAGGCAAATAACTTCCTGTGGCCCTTCAAATTGTCTTCTCCACGAGGTGGAATGAAGAAAAAGACCACCCATTTTGTAGAAGGTGGAGATGCTGGCAACAGGGAGGACCAGATCAACAGGCTTATTAGAAGAATGAACTAAGGTGTCTACCATGATTATTTTTCTAAGCTGGTTGGTTAATAAACAGTACCTGCTCTCAAATTGAAATATATTGTTGTATTTGTGATTTGTTGTTGTTGTTGTTAGCCTGCCTCTGTCTTCCCTTAACTACTGTGGCAAGTGTGGTGTGTGATAAAATTAAGCCAAATCAACAGCCCATTTCGTGCAAAATCAGGGTCGAGTCTGTGTGAAAGACATCTCTTGGGTTTTTAAAAGGCTTTTCTATACAAAAGATTTTAATTTTTTGTTTTTTAACTGTGCTGAGTGATTCGAAATGGGTTTATTCTAAGAAAGCCTGTTTCACAAGCATTTGTACATGATTTGTCGGTAAGGTAATCCAACTTTGGTTTATGGAAAAAATTGAATTTAGTTGCTAAAATTTATTTCTCGGGCCTTCGCTTGTTTATAAACTGCCATGTAAATGTGTTGTTTTCCTTTTGCATTCCATTTTTGTGTTCTTGTTTTGCATCTTTTGCCA