Transcript asmbl_159251

Sequence
Transcript Sequence for observation asmbl_159251 of TGE0058566:
ACTTAAAGAGAGATCTACTTCAGAGCCAGCAGTCCCGCCAGAAGAGGCTGAGCCACACACTGAGCCCGAGGAGCAGGTTCCTGTGGAGGCAGAACCCCAGAATATCGAAGATGAAGCAAAAGAACAAATTCAGTCCCTTCTCCATGAAATGGTACACGCAGAACATGAAACCGAGCATAGTTACCACGTGGAAGAGACAGATTCCAGTGAACCAGTAGTAGAAGATGAAAGATTGCACCATGATACAGATGATGTAACATACCAAGTCTATGAGGAACAAGCAGTATATGAACCTCTAGAAAATGAAGGGATAGAAATCACAGAAGTAACTGCTCCCCCTGAGGATAATCCTGTAGAAGATTCACAGGTAATTGTAGAAGAAGTAAGCATTTTTCCTGTGGAAGAACAGCAGGAAGTACCACCAGAAACAAATAGAAAAACAGATGATCCAGAACAAAAAGCAAAAGTTAAGAAAAAGAAGCCTAAACTTTTAAATAAATTTGATAAGACTATTAAAGCTGAACTTGATGCTGCAGAAAAACTCCGTAAAAGGGGAAAAATTGAGGAAGCAGTGAATGCATTTAAAGAACTAGTACGCAAATACCCTCAGAGTCCACGAGCAAGATATGGGAAGGCGCAGTGTGAGGATGATTTGGCTGAGAAGAGGAGAAGTAATGAGGTGCTACGTGGAGCCATCGAGACCTACCAAGAGGTGGCCAGCCTACCTGATGTCCCTGCAGACCTGCTGAAGCTGAGTTTGAAGCGTCGCTCAGACAGGCAACAATTTCTAGGTCATATGAGAGGTTCCCTGCTTACCCTGCAGAGATTAGTTCAACTATTTCCCAATGATACTTCCTTAAAAAATGACCTTGGCGTGGGATACCTCTTGATAGGAGATAATGACAATGCAAAGAAAGTTTATGAAGAGGTGCTGAGTGTGACACCTAATGATGGCTTTGCTAAAGTCCATTATGGCTTCATCCTGAAGGCACAGAACAAAATTGCTGAGAGCATCCCATATTTAAAGGAAGGAATAGAATCCGGAGATCCTGGCACTGATGATGGGAGATTTTATTTCCACCTGGGGGATGCCATGCAGAGGGTTGGGAACAAAGAGGCATATAAGTGGTATGAGCTTGGGCACAAGAGAGGACACTTTGCATCTGTCTGGCAACGCTCACTCTACAATGTGAATGGACTGAAAGCACAGCCTTGGTGGACCCCAAAAGAAACGGGCTACACAGAGTTAGTAAAGTCTTTAGAAAGAAACTGGAAGTTAATCCGAGATGAAGGCCTTGCAGTGATGGATAAAGCCAAAGGTCTCTTCCTGCCTGAGGATGAAAACCTGAGGGAAAAAGGGGACTGGAGCCAGTTCACGCTGTGGCAGCAAGGAAGAAGAAATGAAAATGCCTGCAAAGGAGCTCCTAAAACCTGTACCTTACTAGAAAAGTTCCCCGAGACAACAGGATGCAGAAGAGGACAGATCAAATATTCCATCATGCACCCCGGGACTCACGTGTGGCCGCACACAGGGCCCACAAACTGCAGGCTCCGAATGCACCTGGGCTTGGTGATTCCCAAGGAAGGCTGCAAGATTCGATGTGCCAACGAGACCAAGACCTGGGAGGAAGGCAAGGTGCTCATCTTTGATGACTCCTTTGAGCACGAGGTATGGCAGGATGCCTCATCTTTCCGGCTGATATTCATCGTGGATGTGTGGCATCCGGAACTGACACCACAGCAGAGACGCAGCCTTCCAGCAATTTAGCATGAATTCATGCAAGCTTGGGAAACTCTGGAGAGAGGCTGCCTTTCTGGTTCCATCTCCTTGGGTGTGAGGATAGAATTTCGAACACCAAGAGTCAATTCCCTTGACTTGCAGCCCGAGTAATTCAAAGCCTCCTCCTAGGGTCAGAAGACACTAAAGGGAATATTTGCCTCGCTGCAATTCATTTAGGAAACACCCTGCTGTGTGTCATCTCATGACAGCACTGGTCTTCTGCCAGTATTTAAGGTGAACATTTGATAGCTTCTACCTTACCAGCCAAAGATATTTTTTCCACATAGAATAGGTCTAATTCAATGTATAATGAGAACATATGTAGAAACTGTGAATGGATTGCTTTAGTTTGTAATTTTTCTATGCAGTTATATTTTTCTAGTGTAGCTAGACTATTTTGTCATCATGTACCACTACATTTTTGTTTATTTTAATGACAAGCTGTATAAATGCTTTACTTCTAGCTATTTAATGGTAGCATTACTGGGGAACTCAGACTTCCCTCTTTTAATTCTTCTTAGTAAAAGATACTCATGAAAAAAGCAGTTTTATTTTCCTAACAAAAAAGAAAGAGCTCATTATGTCAGTGTCTATGAACTGTACCCATCCCAACTCTCAAATCGTTTGGTTTTTTTTATCTTGATTGAGATCCTCTTCTCACTATGCTAGTGGTGGAGATATTGACAAAATCCTATTTCTTTCAAAGAGGAACTTTTCACACCGAAAAAAGAGCATGGAATTATTTTATATTGTTATAAAAATCCCAGATGCAAATTTTTTTAATGCCAATTATTAGAGCTTCTGGGGAAAAAGTATAGTTCACGGAAATAAAACTATGTTCTTTCAGGGTTGGGTGGATAGGTGGCTGCTAGGGTGTCTGGCTCCTGGCGGCTTTGCCATCCATGAGGCAAGGGCTGGGAACACAGTGTCTTTGCCTATGGTAGATCCATGTGAATGTCAGGAAGCCAGCTCTTCAGTCTTGGAGATGATTTCTGCTACAATTCTGTAGAAAGATTAAGGATGGCAGAGTAAAAGGTTACCAAGAATGCCAGGATGTTTTTCTTGGGCGTAGGAGGTCCAGATTACTTTCCTTTTTGATGAAAGAGTTTGGAAGACTGTCCCATCTCTCTGGCTTGAGAAATCTCTGCCATTTTAAACATCACTGTGAAATAGCAATTATTATCATCTGTATTTAGTTTTAACATTACCCACAACATAGAAATAATAGGTAAAAATCGTCTTGCCTACTCATTCCAAAGATGATCAAGTCATTAATCTAGCAAAGTATTCATGTATCAGATTTTGTATATTTTGAATCAAAGCTAACTAGGAATGTTAGATATAAGAATGTAATGATATTCATGCACTGAATTCTAAGCCAATATGAACAAAAATGCTGCATGAATGGCACATATAGGTCACCAAAGTTCATTCACAGGTAGAAAAAACTTGTGCTTTCTTTTCCATCTAAAAACAAAAGGAGACTTTCTTTATCTCATTTAAAGAACAGCTCTTTGAAATTGAAATTGACCCTTTTTGCTTGACCTTAAGGAGATTAGCTTCCAGTAGATGAGTTTGCAAAATACTTTTCCTGTTCTTTTGTTTTGCTGGTATTGAAAACATCCCACTAAATCAGATGAAGAGGCATGGGAGGAAAAATATCCAAATTAATTACTAAAATCGAGAAGAGAAGGCAAACTCTTGAAAAGTAAAAAGGTGTTTGTGACCTTCAGTATTTATTGAACAGAGGAAATAACTGACAAGGGCAATACAATTCAATGTTCATGTAGTAACATTCATGTCACTTGTTGAATTTGGTTCTCATATGTATATTGCATACACATAAATTCAAACTATAAGTCGTCATTTTTGAGCCATCATCTTACATTCATGTAATGAAATTATGGAAGAGAGTAAAAACTAGCTCTTAACTTAGTAAATATAATATGGTATTTAAAATCAGGTCACTACAGTAAGGTTCTAAGTATTGCCAATTGAAAAGCTAGAAATGGTATTACTGTTGCAAAGTGTTGTCAATAATTGACTCCAATAGCATTGTAAATACTTGTATCCCACAACTATTTTAAACCCAAGCAATAAAATGGATTTTCTAATTCACTTCAATTCTTTATTTCTCTTACCTATCTATGTCTTGGTACATAAGAAAAGTGTTTCCATCACTGCATTGGTAGAATTATTTCAGTGTTATTATTTTTGTGATTTCGTATGTCTACACAAAAATGAATTAGTTTAATTTATATTGTGATACAGTTGTTTGAGAAATATTTTTAATTCTGTTTCAACTTTATTTCTCCAAGTGTATAATATAAAAATTACTTCTGTTATTGTTCTCTACCAATAGGGGAAAAAATTAAAACATTAGATCCATTGAGAAAGAGATGATGTAATAAATAATTAAGATTAGTAATAATATTATCAGGGGTGATTATGACCAGTTGAATAATCTCTTTCCCTTGAATTATTTAGCTAACAAATTAACTCTCCCAAATATTTAAAATAATGTAAAATCATATTTTACTGCCCATTATTAACTAAAATATTTTTGTTTGACTTTGAGCACCAACTGGTAATACTAATAAATACCCATGTCATGCAGATGGCTGGGCGAATAAGAGATGTCTAAAAATATGCACTGGTCTTGGAAAACATGGCACAAGTAAGGATATCATATATGATGTCTGTTTATTTTATGTCTGATTTCTTTTGAATGAGTAGTTGGGGACTCCATTTCTAAGGAGACTAGGTAAATAAAATGACCTTTGACATTTCATCCTGCA