Transcript asmbl_159250

Sequence
Transcript Sequence for observation asmbl_159250 of TGE0058565:
AGACAAAGCATGGAGGACACAAGAATGGGAGGAAAGGCGGACTCTCAGGAACTTCATTCTTCACGTGGTTTATGGTGATTGCATTGCTGGGCGTCTGGACATCTGTAGCTGTCGTTTGGTTTGATCTTGTTGACTATGAGGAAGTTCTAGCCAAAGCAAAGGACTTCCGTTATAACTTATCAGAGGTGCTTCAAGGAAAACTAGGAATCTATGATGCTGATGGTGATGGAGATTTTGATGTGGATGATGCCAAAGTTTTATTAGGACTTAAAGAGAGATCTACTTCAGAGCCAGCAGTCCCGCCAGAAGAGGCTGAGCCACACACTGAGCCCGAGGAGCAGGTTCCTGTGGAGGCAGAACCCCAGAATATCGAAGATGAAGCAAAAGAACAAATTCAGTCCCTTCTCCATGAAATGGTACACGCAGAACATGTTGAGGGAGAAGACTTGCAACAAGAAGATGGACCCACAGGAGAACCACAACAAGAGGATGATGAGTTTCTTATGGCGACTGATGTAGATGATAGATTTGAGACCCTGGAACCTGAAGTATCTCATGAAGAAACCGAGCATAGTTACCACGTGGAAGAGACAGATTCCAGTGAACCAGTAGTAGAAGATGAAAGATTGCACCATGATACAGATGATGTAACATACCAAGTCTATGAGGAACAAGCAGTATATGAACCTCTAGAAAATGAAGGGATAGAAATCACAGAAGTAACTGCTCCCCCTGAGGATAATCCTGTAGAAGATTCACAGGTAATTGTAGAAGAAGTAAGCATTTTTCCTGTGGAAGAACAGCAGGAAGTACCACCAGAAACAAATAGAAAAACAGATGATCCAGAACAAAAAGCAAAAGTTAAGAAAAAGAAGCCTAAACTTTTAAATAAATTTGATAAGACTATTAAAGCTGAACTTGATGCTGCAGAAAAACTCCGTAAAAGGGGAAAAATTGAGGAAGCAGTGAATGCATTTAAAGAACTAGTACGCAAATACCCTCAGAGTCCACGAGCAAGATATGGGAAGGCGCAGTGTGAGGATGATTTGGCTGAGAAGAGGAGAAGTAATGAGGTGCTACGTGGAGCCATCGAGACCTACCAAGAGGTGGCCAGCCTACCTGATGTCCCTGCAGACCTGCTGAAGCTGAGTTTGAAGCGTCGCTCAGACAGGCAACAATTTCTAGGTCATATGAGAGGTTCCCTGCTTACCCTGCAGAGATTAGTTCAACTATTTCCCAATGATACTTCCTTAAAAAATGACCTTGGCGTGGGATACCTCTTGATAGGAGATAATGACAATGCAAAGAAAGTTTATGAAGAGGTGCTGAGTGTGACACCTAATGATGGCTTTGCTAAAGTCCATTATGGCTTCATCCTGAAGGCACAGAACAAAATTGCTGAGAGCATCCCATATTTAAAGGAAGGAATAGAATCCGGAGATCCTGGCACTGATGATGGGAGATTTTATTTCCACCTGGGGGATGCCATGCAGAGGGTTGGGAACAAAGAGGCATATAAGTGGTATGAGCTTGGGCACAAGAGAGGACACTTTGCATCTGTCTGGCAACGCTCACTCTACAATGTGAATGGACTGAAAGCACAGCCTTGGTGGACCCCAAAAGAAACGGGCTACACAGAGTTAGTAAAGTCTTTAGAAAGAAACTGGAAGTTAATCCGAGATGAAGGCCTTGCAGTGATGGATAAAGCCAAAGGTCTCTTCCTGCCTGAGGATGAAAACCTGAGGGAAAAAGGGGACTGGAGCCAGTTCACGCTGTGGCAGCAAGGAAGAAGAAATGAAAATGCCTGCAAAGGAGCTCCTAAAACCTGTACCTTACTAGAAAAGTTCCCCGAGACAACAGGATGCAGAAGAGGACAGATCAAATATTCCATCATGCACCCCGGGACTCACGTGTGGCCGCACACAGGGCCCACAAACTGCAGGCTCCGAATGCACCTGGGCTTGGTGATTCCCAAGGAAGGCTGCAAGATTCGATGTGCCAACGAGACCAAGACCTGGGAGGAAGGCAAGGTGCTCATCTTTGATGACTCCTTTGAGCACGAGGTATGGCAGGATGCCTCATCTTTCCGGCTGATATTCATCGTGGATGTGTGGCATCCGGAACTGACACCACAGCAGAGACGCAGCCTTCCAGCAATTTAGCATGAATTCATGCAAGCTTGGGAAACTCTGGAGAGAGGCTGCCTTTCTGGTTCCATCTCCTTGGGTGTGAGGATAGAATTTCGAACACCAAGAGTCAATTCCCTTGACTTGCAGCCCGAGTAATTCAAAGCCTCCTCCTAGGGTCAGAAGACACTAAAGGGAATATTTGCCTCGCTGCAATTCATTTAGGAAACACCCTGCTGTGTGTCATCTCATGACAGCACTGGTCTTCTGCCAGTATTTAAGGTGAACATTTGATAGCTTCTACCTTACCAGCCAAAGATATTTTTTCCACATAGAATAGGTCTAATTCAATGTATAATGAGAACATATGTAGAAACTGTGAATGGATTGCTTTAGTTTGTAATTTTTCTATGCAGTTATATTTTTCTAGTGTAGCTAGACTATTTTGTCATCATGTACCACTACATTTTTGTTTATTTTAATGACAAGCTGTATAAATGCTTTACTTCTAGCTATTTAATGGTAGCATTACTGGGGAACTCAGACTTCCCTCTTTTAATTCTTCTTAGTAAAAGATACTCATGAAAAAAGCAGTTTTATTTTCCTAACAAAAAAGAAAGAGCTCATTATGTCAGTGTCTATGAACTGTACCCATCCCAACTCTCAAATCGTTTGGTTTTTTTTATCTTGATTGAGATCCTCTTCTCACTATGCTAGTGGTGGAGATATTGACAAAATCCTATTTCTTTCAAAGAGGAACTTTTCACACCGAAAAAAGAGCATGGAATTATTTTATATTGTTATAAAAATCCCAGATGCAAATTTTTTTAATGCCAATTATTAGAGCTTCTGGGGAAAAAGTATAGTTCACGGAAATAAAACTATGTTCTTTCAGGGTTGGGTGGATAGGTGGCTGCTAGGGTGTCTGGCTCCTGGCGGCTTTGCCATCCATGAGGCAAGGGCTGGGAACACAGTGTCTTTGCCTATGGTAGATCCATGTGAATGTCAGGAAGCCAGCTCTTCAGTCTTGGAGATGATTTCTGCTACAATTCTGTAGAAAGATTAAGGATGGCAGAGTAAAAGGTTACCAAGAATGCCAGGATGTTTTTCTTGGGCGTAGGAGGTCCAGATTACTTTCCTTTTTGATGAAAGAGTTTGGAAGACTGTCCCATCTCTCTGGCTTGAGAAATCTCTGCCATTTTAAACATCACTGTGAAATAGCAATTATTATCATCTGTATTTAGTTTTAACATTACCCACAACATAGAAATAATAGGTAAAAATCGTCTTGCCTACTCATTCCAAAGATGATCAAGTCATTAATCTAGCAAAGTATTCATGTATCAGATTTTGTATATTTTGAATCAAAGCTAACTAGGAATGTTAGATATAAGAATGTAATGATATTCATGCACTGAATTCTAAGCCAATATGAACAAAAATGCTGCATGAATGGCACATATAGGTCACCAAAGTTCATTCACAGGTAGAAAAAACTTGTGCTTTCTTTTCCATCTAAAAACAAAAGGAGACTTTCTTTATCTCATTTAAAGAACAGCTCTTTGAAATTGAAATTGACCCTTTTTGCTTGACCTTAAGGAGATTAGCTTCCAGTAGATGAGTTTGCAAAATACTTTTCCTGTTCTTTTGTTTTGCTGGTATTGAAAACATCCCACTAAATCAGATGAAGAGGCATGGGAGGAAAAATATCCAAATTAATTACTAAAATCGAGAAGAGAAGGCAAACTCTTGAAAAGTAAAAAGGTGTTTGTGACCTTCAGTATTTATTGAACAGAGGAAATAACTGACAAGGGCAATACAATTCAATGTTCATGTAGTAACATTCATGTCACTTGTTGAATTTGGTTCTCATATGTATATTGCATACACATAAATTCAAACTATAAGTCGTCATTTTTGAGCCATCATCTTACATTCATGTAATGAAATTATGGAAGAGAGTAAAAACTAGCTCTTAACTTAGTAAATATAATATGGTATTTAAAATCAGGTCACTACAGTAAGGTTCTAAGTATTGCCAATTGAAAAGCTAGAAATGGTATTACTGTTGCAAAGTGTTGTCAATAATTGACTCCAATAGCATTGTAAATACTTGTATCCCACAACTATTTTAAACCCAAGCAATAAAATGGATTTTCTAATTCACTTCAATTCTTTATTTCTCTTACCTATCTATGTCTTGGTACATAAGAAAAGTGTTTCCATCACTGCATTGGTAGAATTATTTCAGTGTTATTATTTTTGTGATTTCGTATGTCTACACAAAAATGAATTAGTTTAATTTATATTGTGATACAGTTGTTTGAGAAATATTTTTAATTCTGTTTCAACTTTATTTCTCCAAGTGTATAATATAAAAATTACTTCTGTTATTGTTCTCTACCAATAGGGGAAAAAATTAAAACATTAGATCCATTGAGAAAGAGATGATGTAATAAATAATTAAGATTAGTAATAATATTATCAGGGGTGATTATGACCAGTTGAATAATCTCTTTCCCTTGAATTATTTAGCTAACAAATTAACTCTCCCAAATATTTAAAATAATGTAAAATCATATTTTACTGCCCATTATTAACTAAAATATTTTTGTTTGACTTTGAGCACCAACTGGTAATACTAATAAATACCCATGTCATGCAGATGGCTGGGCGAATAAGAGATGTCTAAAAATATGCACTGGTCTTGGAAAACATGGCACAAGTAAGGATATCATATATGATGTCTGTTTATTTTATGTCTGATTTCTTTTGAATGAGTAGTTGGGGACTCCATTTCTAAGGAGACTAGGTAAATAAAATGACCTTTGACATTTCATCCTGCA