Transcript asmbl_159249

Sequence
Transcript Sequence for observation asmbl_159249 of TGE0058564:
AGACAAAGCATGGAGGACACAAGAATGGGAGGAAAGGCGGACTCTCAGGAACTTCATTCTTCACGTGGTTTATGGTGATTGCATTGCTGGGCGTCTGGACATCTGTAGCTGTCGTTTGGTTTGATCTTGTTGACTATGAGGAAGTTCTAGCCAAAGCAAAGGACTTCCGTTATAACTTATCAGAGGTGCTTCAAGGAAAACTAGGAATCTATGATGCTGATGGTGATGGAGATTTTGATGTGGATGATGCCAAAGTTTTATTAGGACTTAAAGAGAGATCTACTTCAGAGCCAGCAGTCCCGCCAGAAGAGGCTGAGCCACACACTGAGCCCGAGGAGCAGGTTCCTGTGGAGGCAGAACCCCAGAATATCGAAGATGAAGCAAAAGAACAAATTCAGTCCCTTCTCCATGAAATGGTACACGCAGAACATGTTGAGGGAGAAGACTTGCAACAAGAAGATGGACCCACAGGAGAACCACAACAAGAGGATGATGAGTTTCTTATGGCGACTGATGTAGATGATAGATTTGAGACCCTGGAACCTGAAGTATCTCATGAAGAAACCGAGCATAGTTACCACGTGGAAGAGACAGTTTCACAAGACTGTAATCAGGATATGGAAGAGATGATGTCTGAGCAGGAAAATCCAGATTCCAGTGAACCAGTAGTAGAAGATGAAAGATTGCACCATGATACAGATGATGTAACATACCAAGTCTATGAGGAACAAGCAGTATATGAACCTCTAGAAAATGAAGGGATAGAAATCACAGAAGTAACTGCTCCCCCTGAGGATAATCCTGTAGAAGATTCACAGGTAATTGTAGAAGAAACAAATAGAAAAACAGATGATCCAGAACAAAAAGCAAAAGTTAAGAAAAAGAAGCCTAAACTTTTAAATAAATTTGATAAGACTATTAAAGCTGAACTTGATGCTGCAGAAAAACTCCGTAAAAGGGGAAAAATTGAGGAAGCAGTGAATGCATTTAAAGAACTAGTACGCAAATACCCTCAGAGTCCACGAGCAAGATATGGGAAGGCGCAGTGTGAGGATGATTTGGCTGAGAAGAGGAGAAGTAATGAGGTGCTACGTGGAGCCATCGAGACCTACCAAGAGGTGGCCAGCCTACCTGATGTCCCTGCAGACCTGCTGAAGCTGAGTTTGAAGCGTCGCTCAGACAGGCAACAATTTCTAGGTCATATGAGAGGTTCCCTGCTTACCCTGCAGAGATTAGTTCAACTATTTCCCAATGATACTTCCTTAAAAAATGACCTTGGCGTGGGATACCTCTTGATAGGAGATAATGACAATGCAAAGAAAGTTTATGAAGAGGTGCTGAGTGTGACACCTAATGATGGCTTTGCTAAAGTCCATTATGGCTTCATCCTGAAGGCACAGAACAAAATTGCTGAGAGCATCCCATATTTAAAGGAAGGAATAGAATCCGGAGATCCTGGCACTGATGATGGGAGATTTTATTTCCACCTGGGGGATGCCATGCAGAGGGTTGGGAACAAAGAGGCATATAAGTGGTATGAGCTTGGGCACAAGAGAGGACACTTTGCATCTGTCTGGCAACGCTCACTCTACAATGTGAATGGACTGAAAGCACAGCCTTGGTGGACCCCAAAAGAAACGGGCTACACAGAGTTAGTAAAGTCTTTAGAAAGAAACTGGAAGTTAATCCGAGATGAAGGCCTTGCAGTGATGGATAAAGCCAAAGGTCTCTTCCTGCCTGAGGATGAAAACCTGAGGGAAAAAGGGGACTGGAGCCAGTTCACGCTGTGGCAGCAAGGAAGAAGAAATGAAAATGCCTGCAAAGGAGCTCCTAAAACCTGTACCTTACTAGAAAAGTTCCCCGAGACAACAGGATGCAGAAGAGGACAGATCAAATATTCCATCATGCACCCCGGGACTCACGTGTGGCCGCACACAGGGCCCACAAACTGCAGGCTCCGAATGCACCTGGGCTTGGTGATTCCCAAGGAAGGCTGCAAGATTCGATGTGCCAACGAGACCAAGACCTGGGAGGAAGGCAAGGTGCTCATCTTTGATGACTCCTTTGAGCACGAGGTATGGCAGGATGCCTCATCTTTCCGGCTGATATTCATCGTGGATGTGTGGCATCCGGAACTGACACCACAGCAGAGACGCAGCCTTCCAGCAATTTAGCATGAATTCATGCAAGCTTGGGAAACTCTGGAGAGAGGCTGCCTTTCTGGTTCCATCTCCTTGGGTGTGAGGATAGAATTTCGAACACCAAGAGTCAATTCCCTTGACTTGCAGCCCGAGTAATTCAAAGCCTCCTCCTAGGGTCAGAAGACACTAAAGGGAATATTTGCCTCGCTGCAATTCATTTAGGAAACACCCTGCTGTGTGTCATCTCATGACAGCACTGGTCTTCTGCCAGTATTTAAGGTGAACATTTGATAGCTTCTACCTTACCAGCCAAAGATATTTTTTCCACATAGAATAGGTCTAATTCAATGTATAATGAGAACATATGTAGAAACTGTGAATGGATTGCTTTAGTTTGTAATTTTTCTATGCAGTTATATTTTTCTAGTGTAGCTAGACTATTTTGTCATCATGTACCACTACATTTTTGTTTATTTTAATGACAAGCTGTATAAATGCTTTACTTCTAGCTATTTAATGGTAGCATTACTGGGGAACTCAGACTTCCCTCTTTTAATTCTTCTTAGTAAAAGATACTCATGAAAAAAGCAGTTTTATTTTCCTAACAAAAAAGAAAGAGCTCATTATGTCAGTGTCTATGAACTGTACCCATCCCAACTCTCAAATCGTTTGGTTTTTTTTATCTTGATTGAGATCCTCTTCTCACTATGCTAGTGGTGGAGATATTGACAAAATCCTATTTCTTTCAAAGAGGAACTTTTCACACCGAAAAAAGAGCATGGAATTATTTTATATTGTTATAAAAATCCCAGATGCAAATTTTTTTAATGCCAATTATTAGAGCTTCTGGGGAAAAAGTATAGTTCACGGAAATAAAACTATGTTCTTTCAGGGTTGGGTGGATAGGTGGCTGCTAGGGTGTCTGGCTCCTGGCGGCTTTGCCATCCATGAGGCAAGGGCTGGGAACACAGTGTCTTTGCCTATGGTAGATCCATGTGAATGTCAGGAAGCCAGCTCTTCAGTCTTGGAGATGATTTCTGCTACAATTCTGTAGAAAGATTAAGGATGGCAGAGTAAAAGGTTACCAAGAATGCCAGGATGTTTTTCTTGGGCGTAGGAGGTCCAGATTACTTTCCTTTTTGATGAAAGAGTTTGGAAGACTGTCCCATCTCTCTGGCTTGAGAAATCTCTGCCATTTTAAACATCACTGTGAAATAGCAATTATTATCATCTGTATTTAGTTTTAACATTACCCACAACATAGAAATAATAGGTAAAAATCGTCTTGCCTACTCATTCCAAAGATGATCAAGTCATTAATCTAGCAAAGTATTCATGTATCAGATTTTGTATATTTTGAATCAAAGCTAACTAGGAATGTTAGATATAAGAATGTAATGATATTCATGCACTGAATTCTAAGCCAATATGAACAAAAATGCTGCATGAATGGCACATATAGGTCACCAAAGTTCATTCACAGGTAGAAAAAACTTGTGCTTTCTTTTCCATCTAAAAACAAAAGGAGACTTTCTTTATCTCATTTAAAGAACAGCTCTTTGAAATTGAAATTGACCCTTTTTGCTTGACCTTAAGGAGATTAGCTTCCAGTAGATGAGTTTGCAAAATACTTTTCCTGTTCTTTTGTTTTGCTGGTATTGAAAACATCCCACTAAATCAGATGAAGAGGCATGGGAGGAAAAATATCCAAATTAATTACTAAAATCGAGAAGAGAAGGCAAACTCTTGAAAAGTAAAAAGGTGTTTGTGACCTTCAGTATTTATTGAACAGAGGAAATAACTGACAAGGGCAATACAATTCAATGTTCATGTAGTAACATTCATGTCACTTGTTGAATTTGGTTCTCATATGTATATTGCATACACATAAATTCAAACTATAAGTCGTCATTTTTGAGCCATCATCTTACATTCATGTAATGAAATTATGGAAGAGAGTAAAAACTAGCTCTTAACTTAGTAAATATAATATGGTATTTAAAATCAGGTCACTACAGTAAGGTTCTAAGTATTGCCAATTGAAAAGCTAGAAATGGTATTACTGTTGCAAAGTGTTGTCAATAATTGACTCCAATAGCATTGTAAATACTTGTATCCCACAACTATTTTAAACCCAAGCAATAAAATGGATTTTCTAATTCACTTCAATTCTTTATTTCTCTTACCTATCTATGTCTTGGTACATAAGAAAAGTGTTTCCATCACTGCATTGGTAGAATTATTTCAGTGTTATTATTTTTGTGATTTCGTATGTCTACACAAAAATGAATTAGTTTAATTTATATTGTGATACAGTTGTTTGAGAAATATTTTTAATTCTGTTTCAACTTTATTTCTCCAAGTGTATAATATAAAAATTACTTCTGTTATTGTTCTCTACCAATAGGGGAAAAAATTAAAACATTAGATCCATTGAGAAAGAGATGATGTAATAAATAATTAAGATTAGTAATAATATTATCAGGGGTGATTATGACCAGTTGAATAATCTCTTTCCCTTGAATTATTTAGCTAACAAATTAACTCTCCCAAATATTTAAAATAATGTAAAATCATATTTTACTGCCCATTATTAACTAAAATATTTTTGTTTGACTTTGAGCACCAACTGGTAATACTAATAAATACCCATGTCATGCAGATGGCTGGGCGAATAAGAGATGTCTAAAAATATGCACTGGTCTTGGAAAACATGGCACAAGTAAGGATATCATATATGATGTCTGTTTATTTTATGTCTGATTTCTTTTGAATGAGTAGTTGGGGACTCCATTTCTAAGGAGACTAGGTAAATAAAATGACCTTTGACATTTCATCCTGCA