Transcript asmbl_159247

Sequence
Transcript Sequence for observation asmbl_159247 of TGE0058562:
CCAGGTCCCACCGCGCGCCGCCTCCATCCCCCGCGACGCTCCTCCTTTAGGCGCGCGGGGCGGAGGCCGCATTCGGCGGGCCTGGCGGGCGGGCGAGGGGCCAGGCGGACCGGGGTCCGAGCCCTCGGGATGCTAGTCTCGGGGAGCCCCTTCCCAGCGGTTCCTTCACCTGCAGGGCGCAGCCGAGACAGAGGTTGCTGAACGACTGTTTCTTGGCTTTCCGTGGAATTGAACATGGGAGTAAGAGAACAATTTATCGTTTGCCTTGCGTGTTTTGGGGAGTTGAAAATGAGCCAAAGTCAGGGAAAGTGAGTTCCTGCCTAACCAGCAGCGTTTCAGAGCAACTCAAAGGAGAGACAAAGCATGGAGGACACAAGAATGGGAGGAAAGGCGGACTCTCAGGAACTTCATTCTTCACGTGGTTTATGGTGATTGCATTGCTGGGCGTCTGGACATCTGTAGCTGTCGTTTGGTTTGATCTTGTTGACTATGAGGAAGTTCTAGGAAAACTAGGAATCTATGATGCTGATGGTGATGGAGATTTTGATGTGGATGATGCCAAAGTTTTATTAGGACTTAAAGAGAGATCTACTTCAGAGCCAGCAGTCCCGCCAGAAGAGGCTGAGCCACACACTGAGCCCGAGGAGCAGGTTCCTGTGGAGGCAGAACCCCAGAATATCGAAGATGAAGCAAAAGAACAAATTCAGTCCCTTCTCCATGAAATGGTACACGCAGAACATGTTGAGGGAGAAGACTTGCAACAAGAAGATGGACCCACAGGAGAACCACAACAAGAGGATGATGAGTTTCTTATGGCGACTGATGTAGATGATAGATTTGAGACCCTGGAACCTGAAGTATCTCATGAAGAAACCGAGCATAGTTACCACGTGGAAGAGACAGTTTCACAAGACTGTAATCAGGATATGGAAGAGATGATGTCTGAGCAGGAAAATCCAGATTCCAGTGAACCAGTAGTAGAAGATGAAAGATTGCACCATGATACAGATGATGTAACATACCAAGTCTATGAGGAACAAGCAGTATATGAACCTCTAGAAAATGAAGGGATAGAAATCACAGAAGTAACTGCTCCCCCTGAGGATAATCCTGTAGAAGATTCACAGGTAATTGTAGAAGAAGTAAGCATTTTTCCTGTGGAAGAACAGCAGGAAGTACCACCAGAAACAAATAGAAAAACAGATGATCCAGAACAAAAAGCAAAAGTTAAGAAAAAGAAGCCTAAACTTTTAAATAAATTTGATAAGACTATTAAAGCTGAACTTGATGCTGCAGAAAAACTCCGTAAAAGGGGAAAAATTGAGGAAGCAGTGAATGCATTTAAAGAACTAGTACGCAAATACCCTCAGAGTCCACGAGCAAGATATGGGAAGGCGCAGTGTGAGGATGATTTGGCTGAGAAGAGGAGAAGTAATGAGGTGCTACGTGGAGCCATCGAGACCTACCAAGAGGTGGCCAGCCTACCTGATGTCCCTGCAGACCTGCTGAAGCTGAGTTTGAAGCGTCGCTCAGACAGGCAACAATTTCTAGGTCATATGAGAGGTTCCCTGCTTACCCTGCAGAGATTAGTTCAACTATTTCCCAATGATACTTCCTTAAAAAATGACCTTGGCGTGGGATACCTCTTGATAGGAGATAATGACAATGCAAAGAAAGTTTATGAAGAGGTGCTGAGTGTGACACCTAATGATGGCTTTGCTAAAGTCCATTATGGCTTCATCCTGAAGGCACAGAACAAAATTGCTGAGAGCATCCCATATTTAAAGGAAGGAATAGAATCCGGAGATCCTGGCACTGATGATGGGAGATTTTATTTCCACCTGGGGGATGCCATGCAGAGGGTTGGGAACAAAGAGGCATATAAGTGGTATGAGCTTGGGCACAAGAGAGGACACTTTGCATCTGTCTGGCAACGCTCACTCTACAATGTGAATGGACTGAAAGCACAGCCTTGGTGGACCCCAAAAGAAACGGGCTACACAGAGTTAGTAAAGTCTTTAGAAAGAAACTGGAAGTTAATCCGAGATGAAGGCCTTGCAGTGATGGATAAAGCCAAAGGTCTCTTCCTGCCTGAGGATGAAAACCTGAGGGAAAAAGGGGACTGGAGCCAGTTCACGCTGTGGCAGCAAGGAAGAAGAAATGAAAATGCCTGCAAAGGAGCTCCTAAAACCTGTACCTTACTAGAAAAGTTCCCCGAGACAACAGGATGCAGAAGAGGACAGATCAAATATTCCATCATGCACCCCGGGACTCACGTGTGGCCGCACACAGGGCCCACAAACTGCAGGCTCCGAATGCACCTGGGCTTGGTGATTCCCAAGGAAGGCTGCAAGATTCGATGTGCCAACGAGACCAAGACCTGGGAGGAAGGCAAGGTGCTCATCTTTGATGACTCCTTTGAGCACGAGGTATGGCAGGATGCCTCATCTTTCCGGCTGATATTCATCGTGGATGTGTGGCATCCGGAACTGACACCACAGCAGAGACGCAGCCTTCCAGCAATTTAGCATGAATTCATGCAAGCTTGGGAAACTCTGGAGAGAGGCTGCCTTTCTGGTTCCATCTCCTTGGGTGTGAGGATAGAATTTCGAACACCAAGAGTCAATTCCCTTGACTTGCAGCCCGAGTAATTCAAAGCCTCCTCCTAGGGTCAGAAGACACTAAAGGGAATATTTGCCTCGCTGCAATTCATTTAGGAAACACCCTGCTGTGTGTCATCTCATGACAGCACTGGTCTTCTGCCAGTATTTAAGGTGAACATTTGATAGCTTCTACCTTACCAGCCAAAGATATTTTTTCCACATAGAATAGGTCTAATTCAATGTATAATGAGAACATATGTAGAAACTGTGAATGGATTGCTTTAGTTTGTAATTTTTCTATGCAGTTATATTTTTCTAGTGTAGCTAGACTATTTTGTCATCATGTACCACTACATTTTTGTTTATTTTAATGACAAGCTGTATAAATGCTTTACTTCTAGCTATTTAATGGTAGCATTACTGGGGAACTCAGACTTCCCTCTTTTAATTCTTCTTAGTAAAAGATACTCATGAAAAAAGCAGTTTTATTTTCCTAACAAAAAAGAAAGAGCTCATTATGTCAGTGTCTATGAACTGTACCCATCCCAACTCTCAAATCGTTTGGTTTTTTTTATCTTGATTGAGATCCTCTTCTCACTATGCTAGTGGTGGAGATATTGACAAAATCCTATTTCTTTCAAAGAGGAACTTTTCACACCGAAAAAAGAGCATGGAATTATTTTATATTGTTATAAAAATCCCAGATGCAAATTTTTTTAATGCCAATTATTAGAGCTTCTGGGGAAAAAGTATAGTTCACGGAAATAAAACTATGTTCTTTCAGGGTTGGGTGGATAGGTGGCTGCTAGGGTGTCTGGCTCCTGGCGGCTTTGCCATCCATGAGGCAAGGGCTGGGAACACAGTGTCTTTGCCTATGGTAGATCCATGTGAATGTCAGGAAGCCAGCTCTTCAGTCTTGGAGATGATTTCTGCTACAATTCTGTAGAAAGATTAAGGATGGCAGAGTAAAAGGTTACCAAGAATGCCAGGATGTTTTTCTTGGGCGTAGGAGGTCCAGATTACTTTCCTTTTTGATGAAAGAGTTTGGAAGACTGTCCCATCTCTCTGGCTTGAGAAATCTCTGCCATTTTAAACATCACTGTGAAATAGCAATTATTATCATCTGTATTTAGTTTTAACATTACCCACAACATAGAAATAATAGGTAAAAATCGTCTTGCCTACTCATTCCAAAGATGATCAAGTCATTAATCTAGCAAAGTATTCATGTATCAGATTTTGTATATTTTGAATCAAAGCTAACTAGGAATGTTAGATATAAGAATGTAATGATATTCATGCACTGAATTCTAAGCCAATATGAACAAAAATGCTGCATGAATGGCACATATAGGTCACCAAAGTTCATTCACAGGTAGAAAAAACTTGTGCTTTCTTTTCCATCTAAAAACAAAAGGAGACTTTCTTTATCTCATTTAAAGAACAGCTCTTTGAAATTGAAATTGACCCTTTTTGCTTGACCTTAAGGAGATTAGCTTCCAGTAGATGAGTTTGCAAAATACTTTTCCTGTTCTTTTGTTTTGCTGGTATTGAAAACATCCCACTAAATCAGATGAAGAGGCATGGGAGGAAAAATATCCAAATTAATTACTAAAATCGAGAAGAGAAGGCAAACTCTTGAAAAGTAAAAAGGTGTTTGTGACCTTCAGTATTTATTGAACAGAGGAAATAACTGACAAGGGCAATACAATTCAATGTTCATGTAGTAACATTCATGTCACTTGTTGAATTTGGTTCTCATATGTATATTGCATACACATAAATTCAAACTATAAGTCGTCATTTTTGAGCCATCATCTTACATTCATGTAATGAAATTATGGAAGAGAGTAAAAACTAGCTCTTAACTTAGTAAATATAATATGGTATTTAAAATCAGGTCACTACAGTAAGGTTCTAAGTATTGCCAATTGAAAAGCTAGAAATGGTATTACTGTTGCAAAGTGTTGTCAATAATTGACTCCAATAGCATTGTAAATACTTGTATCCCACAACTATTTTAAACCCAAGCAATAAAATGGATTTTCTAATTCACTTCAATTCTTTATTTCTCTTACCTATCTATGTCTTGGTACATAAGAAAAGTGTTTCCATCACTGCATTGGTAGAATTATTTCAGTGTTATTATTTTTGTGATTTCGTATGTCTACACAAAAATGAATTAGTTTAATTTATATTGTGATACAGTTGTTTGAGAAATATTTTTAATTCTGTTTCAACTTTATTTCTCCAAGTGTATAATATAAAAATTACTTCTGTTATTGTTCTCTACCAATAGGGGAAAAAATTAAAACATTAGATCCATTGAGAAAGAGATGATGTAATAAATAATTAAGATTAGTAATAATATTATCAGGGGTGATTATGACCAGTTGAATAATCTCTTTCCCTTGAATTATTTAGCTAACAAATTAACTCTCCCAAATATTTAAAATAATGTAAAATCATATTTTACTGCCCATTATTAACTAAAATATTTTTGTTTGACTTTGAGCACCAACTGGTAATACTAATAAATACCCATGTCATGCAGATGGCTGGGCGAATAAGAGATGTCTAAAAATATGCACTGGTCTTGGAAAACATGGCACAAGTAAGGATATCATATATGATGTCTGTTTATTTTATGTCTGATTTCTTTTGAATGAGTAGTTGGGGACTCCATTTCTAAGGAGACTAGGTAAATAAAATGACCTTTGACATTTCATCCTGCA