Transcript asmbl_159246

Sequence
Transcript Sequence for observation asmbl_159246 of TGE0058561:
ACTTAAAGAGAGATCTACTTCAGAGCCAGCAGTCCCGCCAGAAGAGGCTGAGCCACACACTGAGCCCGAGGAGCAGGTTCCTGTGGAGGCAGAACCCCAGAATATCGAAGATGAAGCAAAAGAACAAATTCAGTCCCTTCTCCATGAAATGGTACACGCAGAACATGAAACCGAGCATAGTTACCACGTGGAAGAGACAGTTTCACAAGACTGTAATCAGGATATGGAAGAGATGATGTCTGAGCAGGAAAATCCAGATTCCAGTGAACCAGTAGTAGAAGATGAAAGATTGCACCATGATACAGATGATGTAACATACCAAGTCTATGAGGAACAAGTATATGAACCTCTAGAAAATGAAGGGATAGAAATCACAGAAGTAACTGCTCCCCCTGAGGATAATCCTGTAGAAGATTCACAGGTAATTGTAGAAGAAGTAAGCATTTTTCCTGTGGAAGAACAGCAGGAAGTACCACCAGAAACAAATAGAAAAACAGATGATCCAGAACAAAAAGCAAAAGTTAAGAAAAAGAAGCCTAAACTTTTAAATAAATTTGATAAGACTATTAAAGCTGAACTTGATGCTGCAGAAAAACTCCGTAAAAGGGGAAAAATTGAGGAAGCAGTGAATGCATTTAAAGAACTAGTACGCAAATACCCTCAGAGTCCACGAGCAAGATATGGGAAGGCGCAGTGTGAGGATGATTTGGCTGAGAAGAGGAGAAGTAATGAGGTGCTACGTGGAGCCATCGAGACCTACCAAGAGGTGGCCAGCCTACCTGATGTCCCTGCAGACCTGCTGAAGCTGAGTTTGAAGCGTCGCTCAGACAGGCAACAATTTCTAGGTCATATGAGAGGTTCCCTGCTTACCCTGCAGAGATTAGTTCAACTATTTCCCAATGATACTTCCTTAAAAAATGACCTTGGCGTGGGATACCTCTTGATAGGAGATAATGACAATGCAAAGAAAGTTTATGAAGAGGTGCTGAGTGTGACACCTAATGATGGCTTTGCTAAAGTCCATTATGGCTTCATCCTGAAGGCACAGAACAAAATTGCTGAGAGCATCCCATATTTAAAGGAAGGAATAGAATCCGGAGATCCTGGCACTGATGATGGGAGATTTTATTTCCACCTGGGGGATGCCATGCAGAGGGTTGGGAACAAAGAGGCATATAAGTGGTATGAGCTTGGGCACAAGAGAGGACACTTTGCATCTGTCTGGCAACGCTCACTCTACAATGTGAATGGACTGAAAGCACAGCCTTGGTGGACCCCAAAAGAAACGGGCTACACAGAGTTAGTAAAGTCTTTAGAAAGAAACTGGAAGTTAATCCGAGATGAAGGCCTTGCAGTGATGGATAAAGCCAAAGGTCTCTTCCTGCCTGAGGATGAAAACCTGAGGGAAAAAGGGGACTGGAGCCAGTTCACGCTGTGGCAGCAAGGAAGAAGAAATGAAAATGCCTGCAAAGGAGCTCCTAAAACCTGTACCTTACTAGAAAAGTTCCCCGAGACAACAGGATGCAGAAGAGGACAGATCAAATATTCCATCATGCACCCCGGGACTCACGTGTGGCCGCACACAGGGCCCACAAACTGCAGGCTCCGAATGCACCTGGGCTTGGTGATTCCCAAGGAAGGCTGCAAGATTCGATGTGCCAACGAGACCAAGACCTGGGAGGAAGGCAAGGTGCTCATCTTTGATGACTCCTTTGAGCACGAGGTATGGCAGGATGCCTCATCTTTCCGGCTGATATTCATCGTGGATGTGTGGCATCCGGAACTGACACCACAGCAGAGACGCAGCCTTCCAGCAATTTAGCATGAATTCATGCAAGCTTGGGAAACTCTGGAGAGAGGCTGCCTTTCTGGTTCCATCTCCTTGGGTGTGAGGATAGAATTTCGAACACCAAGAGTCAATTCCCTTGACTTGCAGCCCGAGTAATTCAAAGCCTCCTCCTAGGGTCAGAAGACACTAAAGGGAATATTTGCCTCGCTGCAATTCATTTAGGAAACACCCTGCTGTGTGTCATCTCATGACAGCACTGGTCTTCTGCCAGTATTTAAGGTGAACATTTGATAGCTTCTACCTTACCAGCCAAAGATATTTTTTCCACATAGAATAGGTCTAATTCAATGTATAATGAGAACATATGTAGAAACTGTGAATGGATTGCTTTAGTTTGTAATTTTTCTATGCAGTTATATTTTTCTAGTGTAGCTAGACTATTTTGTCATCATGTACCACTACATTTTTGTTTATTTTAATGACAAGCTGTATAAATGCTTTACTTCTAGCTATTTAATGGTAGCATTACTGGGGAACTCAGACTTCCCTCTTTTAATTCTTCTTAGTAAAAGATACTCATGAAAAAAGCAGTTTTATTTTCCTAACAAAAAAGAAAGAGCTCATTATGTCAGTGTCTATGAACTGTACCCATCCCAACTCTCAAATCGTTTGGTTTTTTTTATCTTGATTGAGATCCTCTTCTCACTATGCTAGTGGTGGAGATATTGACAAAATCCTATTTCTTTCAAAGAGGAACTTTTCACACCGAAAAAAGAGCATGGAATTATTTTATATTGTTATAAAAATCCCAGATGCAAATTTTTTTAATGCCAATTATTAGAGCTTCTGGGGAAAAAGTATAGTTCACGGAAATAAAACTATGTTCTTTCAGGGTTGGGTGGATAGGTGGCTGCTAGGGTGTCTGGCTCCTGGCGGCTTTGCCATCCATGAGGCAAGGGCTGGGAACACAGTGTCTTTGCCTATGGTAGATCCATGTGAATGTCAGGAAGCCAGCTCTTCAGTCTTGGAGATGATTTCTGCTACAATTCTGTAGAAAGATTAAGGATGGCAGAGTAAAAGGTTACCAAGAATGCCAGGATGTTTTTCTTGGGCGTAGGAGGTCCAGATTACTTTCCTTTTTGATGAAAGAGTTTGGAAGACTGTCCCATCTCTCTGGCTTGAGAAATCTCTGCCATTTTAAACATCACTGTGAAATAGCAATTATTATCATCTGTATTTAGTTTTAACATTACCCACAACATAGAAATAATAGGTAAAAATCGTCTTGCCTACTCATTCCAAAGATGATCAAGTCATTAATCTAGCAAAGTATTCATGTATCAGATTTTGTATATTTTGAATCAAAGCTAACTAGGAATGTTAGATATAAGAATGTAATGATATTCATGCACTGAATTCTAAGCCAATATGAACAAAAATGCTGCATGAATGGCACATATAGGTCACCAAAGTTCATTCACAGGTAGAAAAAACTTGTGCTTTCTTTTCCATCTAAAAACAAAAGGAGACTTTCTTTATCTCATTTAAAGAACAGCTCTTTGAAATTGAAATTGACCCTTTTTGCTTGACCTTAAGGAGATTAGCTTCCAGTAGATGAGTTTGCAAAATACTTTTCCTGTTCTTTTGTTTTGCTGGTATTGAAAACATCCCACTAAATCAGATGAAGAGGCATGGGAGGAAAAATATCCAAATTAATTACTAAAATCGAGAAGAGAAGGCAAACTCTTGAAAAGTAAAAAGGTGTTTGTGACCTTCAGTATTTATTGAACAGAGGAAATAACTGACAAGGGCAATACAATTCAATGTTCATGTAGTAACATTCATGTCACTTGTTGAATTTGGTTCTCATATGTATATTGCATACACATAAATTCAAACTATAAGTCGTCATTTTTGAGCCATCATCTTACATTCATGTAATGAAATTATGGAAGAGAGTAAAAACTAGCTCTTAACTTAGTAAATATAATATGGTATTTAAAATCAGGTCACTACAGTAAGGTTCTAAGTATTGCCAATTGAAAAGCTAGAAATGGTATTACTGTTGCAAAGTGTTGTCAATAATTGACTCCAATAGCATTGTAAATACTTGTATCCCACAACTATTTTAAACCCAAGCAATAAAATGGATTTTCTAATTCACTTCAATTCTTTATTTCTCTTACCTATCTATGTCTTGGTACATAAGAAAAGTGTTTCCATCACTGCATTGGTAGAATTATTTCAGTGTTATTATTTTTGTGATTTCGTATGTCTACACAAAAATGAATTAGTTTAATTTATATTGTGATACAGTTGTTTGAGAAATATTTTTAATTCTGTTTCAACTTTATTTCTCCAAGTGTATAATATAAAAATTACTTCTGTTATTGTTCTCTACCAATAGGGGAAAAAATTAAAACATTAGATCCATTGAGAAAGAGATGATGTAATAAATAATTAAGATTAGTAATAATATTATCAGGGGTGATTATGACCAGTTGAATAATCTCTTTCCCTTGAATTATTTAGCTAACAAATTAACTCTCCCAAATATTTAAAATAATGTAAAATCATATTTTACTGCCCATTATTAACTAAAATATTTTTGTTTGACTTTGAGCACCAACTGGTAATACTAATAAATACCCATGTCATGCAGATGGCTGGGCGAATAAGAGATGTCTAAAAATATGCACTGGTCTTGGAAAACATGGCACAAGTAAGGATATCATATATGATGTCTGTTTATTTTATGTCTGATTTCTTTTGAATGAGTAGTTGGGGACTCCATTTCTAAGGAGACTAGGTAAATAAAATGACCTTTGACATTTCATCCTGCA