Transcript asmbl_158417

Sequence
Transcript Sequence for observation asmbl_158417 of TGE0056432:
AGCTCGCGTCGCCGGGTGAGGAGAACAAAGTGGCTGCACGATTTTCCCCACTTTCCAGCCCACCCCCCGCTTCCGTGGGAGCGACAGGAAATGGAAGGGCGCCTCTTCTCTCTTTGAACATTTGCCTTTTTTCCCCTCCTTTCCACCTCTCCAGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGCATGGGGCTTCTCCAGTTGCTAGCTTTCAGTTTCTTAGCCCTGTGCAGAGCCCGAGTGCGCGCTCAGGAACCCGAGTTCAGCTACGGCTGCGCAGAAGGCAGCTGCTATCCCGCCACGGGCGACCTTCTCATCGGCCGAGCACAGAAGCTTTCGGTGACCTCGACGTGCGGGCTGCACAAGCCCGAACCCTACTGTATCGTCAGCCACTTGCAGGAGGACAAAAAATGCTTCATATGCAATTCCCAAGATCCTTATCATGAGACCCTGAATCCTGACAGCCATCTCATTGAAAATGTGGTCACTACATTTGCTCCAAACCGCCTTAAGATTTGGTGGCAATCTGAAAATGGTGTGGAAAATGTAACTATCCAACTGGATTTGGAAGCAGAATTCCATTTTACTCATCTCATAATGACTTTCAAGACATTCCGTCCAGCTGCTATGCTGATAGAACGATCGTCCGACTTTGGGAAAACCTGGGGTGTGTATAGATACTTCGCCTATGACTGTGAGGCCTCGTTTCCAGGCATTTCAACTGGCCCCATGAAAAAAGTCGATGACATAATTTGTGATTCTCGATATTCTGACATTGAACCCTCAACTGAAGGAGAGGTGATATTTCGTGCTTTAGATCCTGCTTTCAAAATAGAAGATCCTTATAGCCCAAGGATACAGAATTTATTAAAAATTACCAACTTGAGAATCAAGTTTGTGAAACTGCATACTTTGGGAGATAACCTTCTGGATTCCAGGATGGAAATCAGAGAAAAGTATTATTATGCAGTTTATGATATGGTGGTTCGAGGAAATTGCTTCTGCTATGGTCATGCCAGCGAATGTGCCCCTGTGGATGGATTCAATGAAGAAGTGGAAGGAATGGTTCACGGACACTGCATGTGCAGGCATAACACCAAGGGCTTAAACTGTGAACTCTGCATGGATTTCTACCATGATTTACCTTGGAGACCTGCTGAAGGCCGAAACAGCAACGCCTGTAAAAAATGTAACTGCAATGAACATTCCATCTCTTGTCACTTTGACATGGCTGTTTACCTGGCCACGGGGAACGTCAGCGGAGGCGTGTGTGATGACTGTCAGCACAACACCATGGGGCGCAACTGTGAGCAGTGCAAGCCGTTTTACTACCAGCACCCAGAGAGGGACATCCGAGATCCTAATTTCTGTGAACGATGTACGTGTGACCCAGCTGGCTCTCAAAATGAGGGAATTTGTGACAGCTATACTGATTTTTCTACTGGTCTCATTGCTGGCCAGTGTCGGTGTAAATTAAATGTGGAAGGAGAACATTGTGATGTTTGCAAAGAAGGCTTCTATGATTTAAGCAGTGAAGATCCATTTGGTTGTAAATCTTGTGCTTGCAATCCTCTGGGAACAATTCCTGGAGGGAATCCTTGTGATTCCGAGACAGGTCACTGCTACTGCAAGCGTCTGGTGACAGGACAGCATTGTGACCAGTGCCTGCCAGAGCACTGGGGCTTAAGCAATGATTTGGATGGATGTCGACCATGTGACTGTGACCTTGGGGGAGCCTTAAACAACAGTTGCTTTGCGGAGTCAGGCCAGTGCTCATGCCGGCCTCACATGATTGGACGTCAGTGCAACGAAGTGGAACCTGGTTACTACTTTGCCACCCTGGATCACTACCTCTATGAAGCGGAGGAAGCCAACTTGGGGCCTGGGGTTAGCATAGTGGAGCGGCAATATATCCAGGACCGGATTCCCTCCTGGACTGGAGCCGGCTTCGTCCGAGTGCCTGAAGGGGCTTATTTGGAGTTTTTCATTGACAACATACCATATTCCATGGAGTACGACATCCTAATTCGCTACGAGCCACAGCTACCCGACCACTGGGAAAAAGCTGTCATCACAGTGCAGCGACCTGGAAGGATTCCAACCAGCAGCCGATGTGGTAATACCATCCCCGATGATGACAACCAGGTGGTGTCATTATCACCAGGCTCAAGATATGTCGTCCTTCCTCGGCCGGTGTGCTTTGAGAAGGGAACAAACTACACGGTGAGGTTGGAGCTGCCTCAGTACACCTCCTCTGATAGCGACGTGGAGAGCCCCTACACGCTGATCGATTCTCTTGTTCTCATGCCATACTGTAAATCACTGGACATCTTCACCGTGGGAGGTTCAGGAGATGGGGTGGTCACCAACAGTGCCTGGGAAACCTTTCAGAGATACCGATGTCTAGAGAACAGCAGAAGCGTTGTGAAAACACCGATGACAGATGTTTGCAGAAACATCATCTTTAGCATTTCTGCCCTGTTACACCAGACAGGCCTGGCTTGTGAATGCGACCCTCAGGGTTCGTTAAGTTCCGTGTGTGATCCCAACGGAGGCCAGTGCCAGTGCCGGCCCAACGTGGTTGGAAGAACCTGCAACAGATGTGCACCTGGAACTTTTGGCTTTGGCCCCAGTGGATGCAAACCTTGTGAGTGCCATCTGCAAGGATCTGTCAATGCCTTCTGCAATCCCGTCACTGGCCAGTGCCACTGTTTCCAGGGAGTGTATGCTCGGCAGTGTGATCGGTGCTTACCTGGGCACTGGGGCTTTCCAAGTTGCCAGCCCTGCCAGTGCAATGGCCACGCCGATGACTGCGACCCAGTGACTGGGGAGTGCTTGAACTGCCAGGACTACACCATGGGTCATAACTGTGAAAGGTGCTTGGCTGGTTACTATGGCGACCCCATCATTGGGTCAGGAGATCACTGCCGCCCTTGCCCTTGCCCAGATGGTCCCGACAGTGGACGCCAGTTTGCCAGGAGCTGCTACCAAGATCCTGTTACTTTACAGCTTGCCTGTGTTTGTGATCCTGGATACATTGGTTCCAGATGTGACGACTGTGCCTCAGGATACTTTGGCAATCCATCAGAAGTTGGGGGGTCGTGTCAGCCTTGCCAGTGTCACAACAACATTGACACGACAGACCCAGAAGCCTGTGACAAGGAGACTGGGAGGTGTCTCAAGTGCCTGTACCACACGGAAGGGGAACACTGTCAGTTCTGCCGGTTTGGATACTATGGTGATGCCCTCCAGCAGGACTGTCGAAAGTGTGTCTGTAATTACCTGGGCACCGTGCAAGAGCACTGTAACGGCTCTGACTGCCAGTGCGACAAAGCCACTGGTCAGTGCTTGTGTCTTCCTAATGTGATCGGGCAGAACTGTGACCGCTGTGCGCCCAATACCTGGCAGCTGGCCAGTGGCACTGGCTGTGACCCATGCAACTGCAATGCTGCTCATTCCTTCGGGCCATCTTGCAATGAGTTCACGGGGCAGTGCCAGTGCATGCCTGGGTTTGGAGGCCGCACCTGCAGCGAGTGCCAGGAACTCTTCTGGGGAGACCCCGACGTGGAGTGCCGAGCCTGTGACTGTGACCCCAGGGGCATTGAGACGCCACAGTGTGACCAGTCCACGGGCCAGTGTGTCTGCGTTGAGGGTGTTGAGGGTCCACGCTGTGACAAGTGCACGCGAGGGTACTCGGGGGTCTTCCCTGACTGCACACCCTGCCACCAGTGCTTTGCTCTCTGGGATGTGATCATTGCCGAGCTGACCAACAGGACACACAGATTCCTGGAGAAAGCCAAGGCCTTGAAGATCAGTGGTGTGATCGGGCCTTACCGTGAGACTGTGGACTCGGTGGAGAGGAAAGTCAGCGAGATAAAAGACATCCTGGCGCAGAGCCCCGCAGCAGAGCCACTGAAAAACATTGGGAATCTCTTTGAGGAAGCAGAGAAACTGATTAAAGATGTTACAGAAATGATGGCTCAAGTAGAAGTGAAATTATCTGACACAACTTCCCAAAGCAACAGCACAGCCAAAGAACTGGATTCTCTACAGACAGAAGCCGAAAGCCTAGACAACACTGTGAAAGAACTTGCTGAACAACTGGAATTTATCAAAAACTCAGATATTCGGGGTGCCTTGGATAGCATTACCAAGTATTTCCAGATGTCTCTTGAGGCAGAGGAGAGGGTGAATGCCTCCACCACAGAACCCAACAGCACTGTGGAGCAGTCAGCCCTCATGAGAGACAGAGTAGAAGACGTGATGATGGAGCGAGAATCCCAGTTCAAGGAAAAACAAGAGGAGCAGGCTCGCCTCCTTGATGAACTGGCAGGCAAGCTACAAAGCCTAGACCTTTCAGCCGCTGCCGAAATGACCTGTGGAACACCCCCAGGGGCCTCCTGTTCCGAGACTGAATGTGGCGGGCCAAACTGCAGAACTGACGAAGGAGAGAGGAAGTGTGGGGGGCCTGGCTGTGGTGGTCTGGTTACTGTTGCACACAACGCCTGGCAGAAAGCCATGGACTTGGACCAAGATGTCCTGAGTGCCCTGGCTGAAGTGGAACAGCTCTCCAAGATGGTCTCTGAAGCAAAACTGAGGGCAGATGAGGCAAAACAAAGTGCTGAAGACATTCTGTTGAAGACAAATGCTACCAAAGAAAAAATGGACAAGAGCAATGAGGAGCTGAGAAATCTAATCAAGCAAATCAGAAACTTTTTGACCCAGGATAGTGCTGATTTGGACAGCATTGAAGCAGTTGCTAATGAAGTATTGAAAATGGAGATGCCTAGCACCCCACAGCAGTTACAGAACTTGACAGAAGATATACGTGAACGAGTTGAAAGCCTTTCTCAAGTAGAGGTTATTCTTCAGCATAGTGCTGCTGACATTGCCAGAGCTGAGATGTTGTTAGAAGAAGCTAAAAGAGCAAGCAAAAGTGCAACAGATGTTAAAGTCACTGCAGATATGGTAAAGGAAGCTCTGGAAGAAGCAGAAAAGGCCCAGGTCGCAGCAGAGAAGGCAATTAAACAAGCAGATGAAGACATTCAAGGAACCCAGAACCTGTTAACTTCGATTGAGTCTGAAACAGCAGCTTCTGAGGAAACCTTGTTCAACGCGTCCCAGCGCATCAGCGAGTTAGAGAGGAATGTGGAAGAACTTAAGCGGAAAGCTGCCCAAAACTCCGGGGAGGCAGAATATATTGAAAAAGTAGTATATACTGTGAAGCAAAGTGCAGAAGATGTTAAGAAGACTTTAGATGGTGAACTTGATGAAAAGTATAAAAAAGTAGAAAATTTAATTGCCAAAAAAACTGAAGAGTCAGCTGATGCCAGAAGGAAAGCCGAAATGCTACAAAATGAAGCAAAAACTCTTTTAGCTCAAGCAAATAGCAAGCTGCAACTGCTCAAAGATTTAGAAAGAAAATATGAAGACAATCAAAGATACTTAGAAGATAAAGCTCAAGAATTAGCAAGACTGGAAGGAGAAGTCCGTTCACTCCTAAAGGATATAAGCCAGAAAGTTGCTGTGTATAGCACATGCTTGTAACAGAGGAGAATAAAAAATGGCTGAGGTGAACAAGGTAAAACAACTACATTTTAAAAACTGACTTAATGCTCTTCAAAATAAAACATCACCTATTTAATGTTTTTAATCACATTTTGTATGGAGTTAAATAAAGTACAGTGCTTTTGTATATATTTTGGTGTACTTGTTACTTTCACTGATTGTTGATGAATCCCTTTTTTCACTGTAAACGTGGATTTATAAACAAGTTTACTGCGTCCATGAAGA