Transcript asmbl_158416

Sequence
Transcript Sequence for observation asmbl_158416 of TGE0057911:
AAAACTAAAGAATCATTCAACTTGTGCTTTACCACCTAAATAAGCCCATGGGATTATTATTTAGTTTCAGCTTCAGCTTAAGGTGTGGAAAATGTAACTATCCAACTGGATTTGGAAGCAGAATTCCATTTTACTCATCTCATAATGACTTTCAAGACATTCCGTCCAGCTGCTATGCTGATAGAACGATCGTCCGACTTTGGGAAAACCTGGGGTGTGTATAGATACTTCGCCTATGACTGTGAGGCCTCGTTTCCAGGCATTTCAACTGGCCCCATGAAAAAAGTCGATGACATAATTTGTGATTCTCGATATTCTGACATTGAACCCTCAACTGAAGGAGAGGTGATATTTCGTGCTTTAGATCCTGCTTTCAAAATAGAAGATCCTTATAGCCCAAGGATACAGAATTTATTAAAAATTACCAACTTGAGAATCAAGTTTGTGAAACTGCATACTTTGGGAGATAACCTTCTGGATTCCAGGATGGAAATCAGAGAAAAGTATTATTATGCAGTTTATGATATGGTGGTTCGAGGAAATTGCTTCTGCTATGGTCATGCCAGCGAATGTGCCCCTGTGGATGGATTCAATGAAGAAGTGGAAGGAATGGTTCACGGACACTGCATGTGCAGGCATAACACCAAGGGCTTAAACTGTGAACTCTGCATGGATTTCTACCATGATTTACCTTGGAGACCTGCTGAAGGCCGAAACAGCAACGCCTGTAAAAAATGTAACTGCAATGAACATTCCATCTCTTGTCACTTTGACATGGCTGTTTACCTGGCCACGGGGAACGTCAGCGGAGGCGTGTGTGATGACTGTCAGCACAACACCATGGGGCGCAACTGTGAGCAGTGCAAGCCGTTTTACTACCAGCACCCAGAGAGGGACATCCGAGATCCTAATTTCTGTGAACGATGTACGTGTGACCCAGCTGGCTCTCAAAATGAGGGAATTTGTGACAGCTATACTGATTTTTCTACTGGTCTCATTGCTGGCCAGTGTCGGTGTAAATTAAATGTGGAAGGAGAACATTGTGATGTTTGCAAAGAAGGCTTCTATGATTTAAGCAGTGAAGATCCATTTGGTTGTAAATCTTGTGCTTGCAATCCTCTGGGAACAATTCCTGGAGGGAATCCTTGTGATTCCGAGACAGGTCACTGCTACTGCAAGCGTCTGGTGACAGGACAGCATTGTGACCAGTGCCTGCCAGAGCACTGGGGCTTAAGCAATGATTTGGATGGATGTCGACCATGTGACTGTGACCTTGGGGGAGCCTTAAACAACAGTTGCTTTGCGGAGTCAGGCCAGTGCTCATGCCGGCCTCACATGATTGGACGTCAGTGCAACGAAGTGGAACCTGGTTACTACTTTGCCACCCTGGATCACTACCTCTATGAAGCGGAGGAAGCCAACTTGGGGCCTGGGGTTAGCATAGTGGAGCGGCAATATATCCAGGACCGGATTCCCTCCTGGACTGGAGCCGGCTTCGTCCGAGTGCCTGAAGGGGCTTATTTGGAGTTTTTCATTGACAACATACCATATTCCATGGAGTACGACATCCTAATTCGCTACGAGCCACAGCTACCCGACCACTGGGAAAAAGCTGTCATCACAGTGCAGCGACCTGGAAGGATTCCAACCAGCAGCCGATGTGGTAATACCATCCCCGATGATGACAACCAGGTGGTGTCATTATCACCAGGCTCAAGATATGTCGTCCTTCCTCGGCCGGTGTGCTTTGAGAAGGGAACAAACTACACGGTGAGGTTGGAGCTGCCTCAGTACACCTCCTCTGATAGCGACGTGGAGAGCCCCTACACGCTGATCGATTCTCTTGTTCTCATGCCATACTGTAAATCACTGGACATCTTCACCGTGGGAGGTTCAGGAGATGGGGTGGTCACCAACAGTGCCTGGGAAACCTTTCAGAGATACCGATGTCTAGAGAACAGCAGAAGCGTTGTGAAAACACCGATGACAGATGTTTGCAGAAACATCATCTTTAGCATTTCTGCCCTGTTACACCAGACAGGCCTGGCTTGTGAATGCGACCCTCAGGGTTCGTTAAGTTCCGTGTGTGATCCCAACGGAGGCCAGTGCCAGTGCCGGCCCAACGTGGTTGGAAGAACCTGCAACAGATGTGCACCTGGAACTTTTGGCTTTGGCCCCAGTGGATGCAAACCTTGTGAGTGCCATCTGCAAGGATCTGTCAATGCCTTCTGCAATCCCGTCACTGGCCAGTGCCACTGTTTCCAGGGAGTGTATGCTCGGCAGTGTGATCGGTGCTTACCTGGGCACTGGGGCTTTCCAAGTTGCCAGCCCTGCCAGTGCAATGGCCACGCCGATGACTGCGACCCAGTGACTGGGGAGTGCTTGAACTGCCAGGACTACACCATGGGTCATAACTGTGAAAGGTGCTTGGCTGGTTACTATGGCGACCCCATCATTGGGTCAGGAGATCACTGCCGCCCTTGCCCTTGCCCAGATGGTCCCGACAGTGGACGCCAGTTTGCCAGGAGCTGCTACCAAGATCCTGTTACTTTACAGCTTGCCTGTGTTTGTGATCCTGGATACATTGGTTCCAGATGTGACGACTGTGCCTCAGGATACTTTGGCAATCCATCAGAAGTTGGGGGGTCGTGTCAGCCTTGCCAGTGTCACAACAACATTGACACGACAGACCCAGAAGCCTGTGACAAGGAGACTGGGAGGTGTCTCAAGTGCCTGTACCACACGGAAGGGGAACACTGTCAGTTCTGCCGGTTTGGATACTATGGTGATGCCCTCCAGCAGGACTGTCGAAAGTGTGTCTGTAATTACCTGGGCACCGTGCAAGAGCACTGTAACGGCTCTGACTGCCAGTGCGACAAAGCCACTGGTCAGTGCTTGTGTCTTCCTAATGTGATCGGGCAGAACTGTGACCGCTGTGCGCCCAATACCTGGCAGCTGGCCAGTGGCACTGGCTGTGACCCATGCAACTGCAATGCTGCTCATTCCTTCGGGCCATCTTGCAATGAGTTCACGGGGCAGTGCCAGTGCATGCCTGGGTTTGGAGGCCGCACCTGCAGCGAGTGCCAGGAACTCTTCTGGGGAGACCCCGACGTGGAGTGCCGAGCCTGTGACTGTGACCCCAGGGGCATTGAGACGCCACAGTGTGACCAGTCCACGGGCCAGTGTGTCTGCGTTGAGGGTGTTGAGGGTCCACGCTGTGACAAGTGCACGCGAGGGTACTCGGGGGTCTTCCCTGACTGCACACCCTGCCACCAGTGCTTTGCTCTCTGGGATGTGATCATTGCCGAGCTGACCAACAGGACACACAGATTCCTGGAGAAAGCCAAGGCCTTGAAGATCAGTGGTGTGATCGGGCCTTACCGTGAGACTGTGGACTCGGTGGAGAGGAAAGTCAGCGAGATAAAAGACATCCTGGCGCAGAGCCCCGCAGCAGAGCCACTGAAAAACATTGGGAATCTCTTTGAGGAAGCAGAGAAACTGATTAAAGATGTTACAGAAATGATGGCTCAAGTAGAAGTGAAATTATCTGACACAACTTCCCAAAGCAACAGCACAGCCAAAGAACTGGATTCTCTACAGACAGAAGCCGAAAGCCTAGACAACACTGTGAAAGAACTTGCTGAACAACTGGAATTTATCAAAAACTCAGATATTCGGGGTGCCTTGGATAGCATTACCAAGTATTTCCAGATGTCTCTTGAGGCAGAGGAGAGGGTGAATGCCTCCACCACAGAACCCAACAGCACTGTGGAGCAGTCAGCCCTCATGAGAGACAGAGTAGAAGACGTGATGATGGAGCGAGAATCCCAGTTCAAGGAAAAACAAGAGGAGCAGGCTCGCCTCCTTGATGAACTGGCAGGCAAGCTACAAAGCCTAGACCTTTCAGCCGCTGCCGAAATGACCTGTGGAACACCCCCAGGGGCCTCCTGTTCCGAGACTGAATGTGGCGGGCCAAACTGCAGAACTGACGAAGGAGAGAGGAAGTGTGGGGGGCCTGGCTGTGGTGGTCTGGTTACTGTTGCACACAACGCCTGGCAGAAAGCCATGGACTTGGACCAAGATGTCCTGAGTGCCCTGGCTGAAGTGGAACAGCTCTCCAAGATGGTCTCTGAAGCAAAACTGAGGGCAGATGAGGCAAAACAAAGTGCTGAAGACATTCTGTTGAAGACAAATGCTACCAAAGAAAAAATGGACAAGAGCAATGAGGAGCTGAGAAATCTAATCAAGCAAATCAGAAACTTTTTGACCCAGGATAGTGCTGATTTGGACAGCATTGAAGCAGTTGCTAATGAAGTATTGAAAATGGAGATGCCTAGCACCCCACAGCAGTTACAGAACTTGACAGAAGATATACGTGAACGAGTTGAAAGCCTTTCTCAAGTAGAGGTTATTCTTCAGCATAGTGCTGCTGACATTGCCAGAGCTGAGATGTTGTTAGAAGAAGCTAAAAGAGCAAGCAAAAGTGCAACAGATGTTAAAGTCACTGCAGATATGGTAAAGGAAGCTCTGGAAGAAGCAGAAAAGGCCCAGGTCGCAGCAGAGAAGGCAATTAAACAAGCAGATGAAGACATTCAAGGAACCCAGAACCTGTTAACTTCGATTGAGTCTGAAACAGCAGCTTCTGAGGAAACCTTGTTCAACGCGTCCCAGCGCATCAGCGAGTTAGAGAGGAATGTGGAAGAACTTAAGCGGAAAGCTGCCCAAAACTCCGGGGAGGCAGAATATATTGAAAAAGTAGTATATACTGTGAAGCAAAGTGCAGAAGATGTTAAGAAGACTTTAGATGGTGAACTTGATGAAAAGTATAAAAAAGTAGAAAATTTAATTGCCAAAAAAACTGAAGAGTCAGCTGATGCCAGAAGGAAAGCCGAAATGCTACAAAATGAAGCAAAAACTCTTTTAGCTCAAGCAAATAGCAAGCTGCAACTGCTCAAAGATTTAGAAAGAAAATATGAAGACAATCAAAGATACTTAGAAGATAAAGCTCAAGAATTAGCAAGACTGGAAGGAGAAGTCCGTTCACTCCTAAAGGATATAAGCCAGAAAGTTGCTGTGTATAGCACATGCTTGTAACAGAGGAGAATAAAAAATGGCTGAGGTGAACAAGGTAAAACAACTACATTTTAAAAACTGACTTAATGCTCTTCAAAATAAAACATCACCTATTTAATGTTTTTAATCACATTTTGTATGGAGTTAAATAAAGTACAGTGCTTTTGTATATATTTTGGTGTACTTGTTACTTTCACTGATTGTTGATGAATCCCTTTTTTCACTGTAAACGTGGATTTATAAACAAGTTTACTGCGTCCATGAAGA