Transcript asmbl_158410

Sequence
Transcript Sequence for observation asmbl_158410 of TGE0058559:
GGGGGGTGGGACCGGGACCTCACCCGGTCCTCGCAGAGTTGCGGCCGCCCGCCCCTTCAGCCCCGGCTCTCCGTATGCGCATGAGCAGAGGCGCCTCCCTCTGTTCCTCCCAAGGCTAAACTTTCTAATTCCCTTCTTTGGGCTCGGGGGCTCCCGGAGCAGGGCGAGAGCTCGCGTCGCCGGAAAGGAAGACGGGAAGAAAGGGCAGGCGGCTCGGCGGGCGTCTTCTCCACTCCTCTGCCGCGTCCCCGTGGCTGCAGGGAGCCGGCATGGGGCTTCTCCAGTTGCTAGCTTTCAGTTTCTTAGCCCTGTGCAGAGCCCGAGTGCGCGCTCAGGAACCCGAGTTCAGCTACGGCTGCGCAGAAGGCAGCTGCTATCCCGCCACGGGCGACCTTCTCATCGGCCGAGCACAGAAGCTTTCGGTGACCTCGACGTGCGGGCTGCACAAGCCCGAACCCTACTGTATCGTCAGCCACTTGCAGGAGGACAAAAAATGCTTCATATGCAATTCCCAAGATCCTTATCATGAGACCCTGAATCCTGACAGCCATCTCATTGAAAATGTGGTCACTACATTTGCTCCAAACCGCCTTAAGATTTGGTGGCAATCTGAAAATGGTGTGGAAAATGTAACTATCCAACTGGATTTGGAAGCAGAATTCCATTTTACTCATCTCATAATGACTTTCAAGACATTCCGTCCAGCTGCTATGCTGATAGAACGATCGTCCGACTTTGGGAAAACCTGGGGTGTGTATAGATACTTCGCCTATGACTGTGAGGCCTCGTTTCCAGGCATTTCAACTGGCCCCATGAAAAAAGTCGATGACATAATTTGTGATTCTCGATATTCTGACATTGAACCCTCAACTGAAGGAGAGGTGATATTTCGTGCTTTAGATCCTGCTTTCAAAATAGAAGATCCTTATAGCCCAAGGATACAGAATTTATTAAAAATTACCAACTTGAGAATCAAGTTTGTGAAACTGCATACTTTGGGAGATAACCTTCTGGATTCCAGGATGGAAATCAGAGAAAAGTATTATTATGCAGTTTATGATATGGTGGTTCGAGGAAATTGCTTCTGCTATGGTCATGCCAGCGAATGTGCCCCTGTGGATGGATTCAATGAAGAAGTGGAAGGAATGGTTCACGGACACTGCATGTGCAGGCATAACACCAAGGGCTTAAACTGTGAACTCTGCATGGATTTCTACCATGATTTACCTTGGAGACCTGCTGAAGGCCGAAACAGCAACGCCTGTAAAAAATGTAACTGCAATGAACATTCCATCTCTTGTCACTTTGACATGGCTGTTTACCTGGCCACGGGGAACGTCAGCGGAGGCGTGTGTGATGACTGTCAGCACAACACCATGGGGCGCAACTGTGAGCAGTGCAAGCCGTTTTACTACCAGCACCCAGAGAGGGACATCCGAGATCCTAATTTCTGTGAACGATGTACGTGTGACCCAGCTGGCTCTCAAAATGAGGGAATTTGTGACAGCTATACTGATTTTTCTACTGGTCTCATTGCTGGCCAGTGTCGGTGTAAATTAAATGTGGAAGGAGAACATTGTGATGTTTGCAAAGAAGGCTTCTATGATTTAAGCAGTGAAGATCCATTTGGTTGTAAATCTTGTGCTTGCAATCCTCTGGGAACAATTCCTGGAGGGAATCCTTGTGATTCCGAGACAGGTCACTGCTACTGCAAGCGTCTGGTGACAGGACAGCATTGTGACCAGTGCCTGCCAGAGCACTGGGGCTTAAGCAATGATTTGGATGGATGTCGACCATGTGACTGTGACCTTGGGGGAGCCTTAAACAACAGTTGCTTTGCGGAGTCAGGCCAGTGCTCATGCCGGCCTCACATGATTGGACGTCAGTGCAACGAAGTGGAACCTGGTTACTACTTTGCCACCCTGGATCACTACCTCTATGAAGCGGAGGAAGCCAACTTGGGGCCTGGGGTTAGCATAGTGGAGCGGCAATATATCCAGGACCGGATTCCCTCCTGGACTGGAGCCGGCTTCGTCCGAGTGCCTGAAGGGGCTTATTTGGAGTTTTTCATTGACAACATACCATATTCCATGGAGTACGACATCCTAATTCGCTACGAGCCACAGCTACCCGACCACTGGGAAAAAGCTGTCATCACAGTGCAGCGACCTGGAAGGATTCCAACCAGCAGCCGATGTGGTAATACCATCCCCGATGATGACAACCAGGTGGTGTCATTATCACCAGGCTCAAGATATGTCGTCCTTCCTCGGCCGGTGTGCTTTGAGAAGGGAACAAACTACACGGTGAGGTTGGAGCTGCCTCAGTACACCTCCTCTGATAGCGACGTGGAGAGCCCCTACACGCTGATCGATTCTGTAAGTGCGAGATTGCTTCTGGCATATGCAGGAAAGCCTGGGCGGAAAGTGCCCAGCTGCTCTCAGGGTGTTTTGTTGAGGGGTAATGCTGAGGCCAGCGTAA