Transcript asmbl_158175

Sequence
Transcript Sequence for observation asmbl_158175 of TGE0058558:
TCAGCAGCACCGCAGTATAGAAGTTCCGGTCCTTCCAGCTGCTGGGATTCTCAGCTTGAACTCTTCCAGGAAACAAGTTCTTTTCCGCTTCTCTTGCGAAATCCAGCAGACCGTCCCGCCCTTCTCTGGCTTCTTATAGCAGCGAGAGCCACAAGCCACAGCGCTGAGCTGCAGGCGCGGCGAAACTTCCCTCTACCCGCCCGGCCCGCGGCGCGCACCGTTGGCGCTGGACGCTTCCTCCTTGGAAGCGCCTCTCCCTCAGTTATGGAGAAAACTTGTATAGATGCACTTCCTCTTACTATGAATTCTTCAGAAAAGCAAGAGACTGTATGTATTTTTGGAACTGGTGATTTTGGAAGATCACTGGGATTGAAAATGCTCCAGTGTGGTTATTCTGTTGTTTTTGGAAGTCGAAACCCCCAGAAGACCACCCTACTGCCCAGTGGTGCAGAAGTCTTGAGCTATTCAGAAGCAGCCAAGAAGTCTGGCATCATAATCATAGCAATCCACAGAGAGCATTATGATTTTCTCACAGAATTAACTGAGGTTCTCAATGGAAAAATATTGGTAGACATCAGCAACAACCTCAAAATCAATCAATATCCAGAATCTAATGCAGAGTACCTTGCTCATTTGGTGCCAGGAGCCCACGTGGTAAAAGCATTTAACACCATCTCAGCCTGGGCTCTCCAGTCAGGAGCACTGGATGCAAGTCGGCAGGTGTTTGTGTGTGGAAATGACAGCAAAGCCAAGCAAAGAGTGATGGATATTGTTCGTAATCTTGGACTTACTCCAATGGATCAAGGATCACTCATGGCAGCCAAAGAAATTGAAAAGTACCCCCTGCAGCTATTTCCAATGTGGAGGTTCCCCTTCTATTTGTCTGCTGTGCTGTGTGTCTTCTTGTTTTTCTATTGTGTTATAAGAGACGTAATCTACCCTTATGTTTATGAAAAGAAAGATAATACATTTCGTATGGCTATTTCCATTCCAAATCGTATCTTTCCAATAACAGCACTTACACTGCTTGCTTTGGTTTACCTCCCTGGTGTTATTGCTGCCATTCTACAACTGTACCGAGGCACAAAATACCGTCGATTCCCAGACTGGCTTGACCACTGGATGCTTTGCCGAAAGCAGCTTGGCTTGGTAGCTCTGGGATTTGCCTTCCTTCATGTCCTCTACACACTTGTGATTCCTATTCGATATTATGTACGATGGAGATTGGGAAACTTAACCGTTACCCAGGTAAATCTCTTCTTATATATTTTCTTCTGCTCCTGAAATCAGAGACTATTGCTACATCATATTCCATTTCATAATTATAGAAAGTCACTCTTCTAAGCATCTTCTTTTTTAAAGTAACTAGAATTAGAAATGTCATGTCAGTTTTTTAAAATGAATCCAGTTTAGATCTCATACAACTATTAAGAATAAAAGTTTGCCGGGGGCGGTGGCTCACTCCCATAATCCCAGCACTTTGGGATTCC