Transcript asmbl_157943

Sequence
Transcript Sequence for observation asmbl_157943 of TGE0058557:
GCATTGGCCACAGCAGCGCGAGGCGGGCACGGGGTATTGTCCGGCTCCGGCGGCGGCGGTCGGTGCTGCGAGAGCGGCGGCGGCGGCGCGGGTCGGCAGCGGGAGGGCGCGCGGCCGAGCGGAGGCGGAGTCGGCGCCGAGAACATGGCTGGAGGCAAAGCTGGAAAGGACAGTGGGAAGGCCAAGGCTAAGGCAGTATCTCGCTCACAGAGAGCTGGGCTACAGTTTCCTGTGGGCCGCATCCACAGACACTTGAAGACTCGCACCACAAGCCATGGAAGGGTGGGTGCCACTGCTGCCGTGTACAGTGCTGCGATTCTGGAGTACCTCACTGCAGAGGTGCTGGAGCTGGCAGGTAATGCTTCTAAGGATCTCAAAGTAAAGCGTATCACTCCGCGTCACTTGCAGCTTGCAATCCGTGGTGATGAAGAGTTGGATTCTCTTATCAAGGCTACCATAGCTGGGGGTGGTGTGATCCCTCACATCCACAAATCTCTGATTGGAAAGAAGGGACAGCAGAAAACTGCTTAGAGGGATGCTTTAACCAACCCTCTTCCTCCCCGTCATTGTACTGTAACTGGGACAGAAGAAATAATGGGGATATGTGGAATTTTTAACAACAGTTAAATGGAAAAGCATAGACAATTACTGTAGACATGATAAAAGAAACATTTGTATGTTCTTAGACTCGAAGTTTGATAAAAGTACCTTTTCATGTGGTGACAGTTGTGTGTTGATTGGCTAGGTTTCTCCCGTGTGTTTTATACAAAAATGGAATTGATAAACCATTTTTTACAAAATTAATTTGTCTCAAAACTGTTCTGTTCATGATGTATTAGAAATATTTTACTCAGACTTTAAATATTTTAAATCTCAGATTGGTTATTCAGAGTAACCTTAGAACAGAAATTGGGAATATATCTTTACAATGATTGATACCATGGTATATTGACTCTTAGATGCTATTGATCTGTAGCACCATTTTTTACAAACGACTAAGGAAAAAACCTGCCAATTAAATCATGATATGCCATCAATTATGAGACATCCCAATTTGAGAGATGTTAGATTATAGAAAAGTATGCATTTATGACTGAAATGGTAGTGGAATTATTTGAATTCTACACCAAGCACTTACCATGTGCCAGGCCCTTTGCAGAGTGCTCTACTGACCAAGAAAGTTGTTGCTGCCACATTATAGATGTGGAGCCTAAGGGTCACAGAAATTGTGTGCTATGCCAAAAAACATTGAACTGGTAGATAGAAAATGACAGAGCTAGGATTCAAACCTAGATCTGGCTGACTCCAGAGCCTAGTTTTACCTGGAATTGATGTTCAGTTTATCAAAGGTTTCTCCTTTTGGTTTAAAATCCCAATTTTTGGCCTGGCATTGTGGTTTACGCCTGTAATCCCAACACTTCGGGAGACCGAGGCTGGTGGAACACTTGAGGTCAGGAGTTTGAGA